Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Qrich1'

391699

Institutional Source

Beutler Lab

Gene Symbol

Qrich1

Ensembl Gene

ENSMUSG00000006673

Gene Name

glutamine-rich 1

Synonyms

2610028H07Rik

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108516806-108560163 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108541736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 464 (P464S)

Ref Sequence

ENSEMBL: ENSMUSP00000141267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006851] [ENSMUST00000112155] [ENSMUST00000193258] [ENSMUST00000194385]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000006851
AA Change: P464S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673
AA Change: P464S

Domain	Start	End	E-Value	Type
low complexity region	79	123	N/A	INTRINSIC
low complexity region	128	146	N/A	INTRINSIC
low complexity region	150	192	N/A	INTRINSIC
low complexity region	419	443	N/A	INTRINSIC
low complexity region	457	478	N/A	INTRINSIC
Pfam:DUF3504	597	761	1.8e-65	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112155
AA Change: P464S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673
AA Change: P464S

Domain	Start	End	E-Value	Type
low complexity region	79	123	N/A	INTRINSIC
low complexity region	128	146	N/A	INTRINSIC
low complexity region	150	192	N/A	INTRINSIC
low complexity region	419	443	N/A	INTRINSIC
low complexity region	457	478	N/A	INTRINSIC
Pfam:DUF3504	600	760	2.3e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192908

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193258
AA Change: P464S

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141267
Gene: ENSMUSG00000006673
AA Change: P464S

Domain	Start	End	E-Value	Type
SCOP:d1dgna_	7	48	9e-3	SMART
low complexity region	79	123	N/A	INTRINSIC
low complexity region	128	146	N/A	INTRINSIC
low complexity region	150	192	N/A	INTRINSIC
low complexity region	419	443	N/A	INTRINSIC
low complexity region	457	478	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000194385
AA Change: P120S

SMART Domains

Protein: ENSMUSP00000142211
Gene: ENSMUSG00000006673
AA Change: P120S

Domain	Start	End	E-Value	Type
SCOP:d1cy5a_	9	45	8e-3	SMART
low complexity region	79	134	N/A	INTRINSIC

Meta Mutation Damage Score

0.0790

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects including overriding aorta, double outlet right ventricle with atrioventricular septal defects and ventricular non-compaction, as well as cleft palate, cystic kidneys, and thymus hypoplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Qrich1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03136:Qrich1	APN	9	108544918	missense	probably damaging	1.00
R0240:Qrich1	UTSW	9	108534134	missense	probably damaging	1.00
R0240:Qrich1	UTSW	9	108534134	missense	probably damaging	1.00
R0586:Qrich1	UTSW	9	108534520	missense	probably damaging	0.98
R0648:Qrich1	UTSW	9	108544877	missense	probably damaging	1.00
R1460:Qrich1	UTSW	9	108533647	unclassified	probably benign
R1478:Qrich1	UTSW	9	108559332	missense	probably benign	0.02
R1631:Qrich1	UTSW	9	108534485	missense	probably damaging	0.99
R1964:Qrich1	UTSW	9	108534422	missense	possibly damaging	0.92
R1984:Qrich1	UTSW	9	108534047	missense	probably damaging	0.99
R2054:Qrich1	UTSW	9	108559270	missense	possibly damaging	0.92
R4539:Qrich1	UTSW	9	108534200	missense	probably damaging	1.00
R5353:Qrich1	UTSW	9	108544965	missense	probably damaging	1.00
R5510:Qrich1	UTSW	9	108556460	missense	possibly damaging	0.69
R5604:Qrich1	UTSW	9	108559303	unclassified	probably benign
R5718:Qrich1	UTSW	9	108528823	missense	probably damaging	1.00
R5743:Qrich1	UTSW	9	108534115	missense	probably damaging	1.00
R5853:Qrich1	UTSW	9	108533608	unclassified	probably benign
R6317:Qrich1	UTSW	9	108534292	missense	probably damaging	1.00
R6470:Qrich1	UTSW	9	108534518	missense	probably damaging	0.98
R6552:Qrich1	UTSW	9	108534305	missense	possibly damaging	0.61
R6671:Qrich1	UTSW	9	108533786	missense	probably benign	0.03
R6858:Qrich1	UTSW	9	108534134	missense	probably damaging	1.00
R7453:Qrich1	UTSW	9	108556476	missense	possibly damaging	0.93
R7842:Qrich1	UTSW	9	108556368	splice site	probably null
R7879:Qrich1	UTSW	9	108559286	missense	possibly damaging	0.92
R8073:Qrich1	UTSW	9	108534428	missense	possibly damaging	0.56
R8158:Qrich1	UTSW	9	108556037	missense	probably damaging	0.99
R8241:Qrich1	UTSW	9	108556561	critical splice donor site	probably null
R8875:Qrich1	UTSW	9	108559303	unclassified	probably benign
R9532:Qrich1	UTSW	9	108534320	missense	probably benign	0.36
R9795:Qrich1	UTSW	9	108533890	missense	probably benign	0.18
Z1177:Qrich1	UTSW	9	108534469	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGACAGCAAGAATTGGTTTTG -3'
(R):5'- ATTCTCCAGTCCTTAAGGCCAG -3'

Sequencing Primer
(F):5'- ACAGCAAGAATTGGTTTTGGTTGTTG -3'
(R):5'- TTAAGGCCAGGGGTGCTAC -3'

Posted On

2016-06-06