Incidental Mutation 'R5031:Rspo3'
ID 391700
Institutional Source Beutler Lab
Gene Symbol Rspo3
Ensembl Gene ENSMUSG00000019880
Gene Name R-spondin 3
Synonyms 2810459H04Rik, Cristin1, Thsd2
MMRRC Submission 042622-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5031 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 29329102-29411863 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29382443 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 77 (L77H)
Ref Sequence ENSEMBL: ENSMUSP00000090287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092623]
AlphaFold Q2TJ95
Predicted Effect probably damaging
Transcript: ENSMUST00000092623
AA Change: L77H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090287
Gene: ENSMUSG00000019880
AA Change: L77H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FU 35 86 4.74e-6 SMART
FU 92 135 3.79e-5 SMART
EGF 97 126 2.39e1 SMART
TSP1 150 207 1.56e-6 SMART
low complexity region 248 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215256
Meta Mutation Damage Score 0.9187 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, embryonic growth arrest, and impaired fetal placental vascular development. Mice homozygous for a conditional allele activated in limbs exhibit slight limb shortening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,247,678 (GRCm39) N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 (GRCm39) K231R probably damaging Het
Ank1 C T 8: 23,589,696 (GRCm39) P599L probably damaging Het
Arhgef19 A G 4: 140,978,121 (GRCm39) E580G probably damaging Het
Atr A G 9: 95,747,755 (GRCm39) K346E probably damaging Het
AU021092 T C 16: 5,030,468 (GRCm39) K309E probably damaging Het
Baz2b T C 2: 59,743,151 (GRCm39) R1607G probably benign Het
Cct8 C T 16: 87,284,426 (GRCm39) V254M probably damaging Het
Cdca2 T A 14: 67,950,602 (GRCm39) I110F probably damaging Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Dmkn A G 7: 30,463,661 (GRCm39) I105V probably benign Het
Dock1 A G 7: 134,753,975 (GRCm39) D1584G probably benign Het
Epg5 G A 18: 78,072,163 (GRCm39) V2392I probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gsap G A 5: 21,447,824 (GRCm39) S294N possibly damaging Het
Hectd2 A G 19: 36,577,004 (GRCm39) N142D probably damaging Het
Hmcn1 A G 1: 150,464,008 (GRCm39) C5091R probably damaging Het
Ifitm5 G A 7: 140,530,017 (GRCm39) R36* probably null Het
Ints2 G A 11: 86,147,026 (GRCm39) P40L probably damaging Het
Irs1 A T 1: 82,264,688 (GRCm39) L1176* probably null Het
Klhl29 C T 12: 5,141,334 (GRCm39) R550Q probably benign Het
Kyat1 A G 2: 30,078,102 (GRCm39) M134T probably damaging Het
Lrrk2 A T 15: 91,584,822 (GRCm39) N384Y possibly damaging Het
Magel2 T C 7: 62,029,852 (GRCm39) S919P unknown Het
Mettl16 A T 11: 74,693,825 (GRCm39) I279F probably benign Het
Mmut T C 17: 41,249,718 (GRCm39) F231S possibly damaging Het
Mrgpra1 A T 7: 46,984,985 (GRCm39) Y231* probably null Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mvp A C 7: 126,592,788 (GRCm39) Y374* probably null Het
Nabp2 G A 10: 128,245,497 (GRCm39) probably benign Het
Nos1 C T 5: 118,017,378 (GRCm39) P247L probably benign Het
Or10ag53 C A 2: 87,082,426 (GRCm39) F48L probably benign Het
Or9g4b T A 2: 85,616,062 (GRCm39) L69* probably null Het
Pik3cb C T 9: 98,953,461 (GRCm39) D441N probably damaging Het
Qrich1 C T 9: 108,418,935 (GRCm39) P464S possibly damaging Het
Rab17 A T 1: 90,887,860 (GRCm39) probably null Het
Relch A G 1: 105,592,239 (GRCm39) N136S probably damaging Het
Spn G T 7: 126,736,402 (GRCm39) T35K probably benign Het
Sult1d1 T A 5: 87,707,703 (GRCm39) Y139F possibly damaging Het
Tbc1d32 C A 10: 55,999,627 (GRCm39) Q848H probably damaging Het
Tcaf3 A G 6: 42,573,867 (GRCm39) V115A probably benign Het
Tram1l1 T A 3: 124,115,293 (GRCm39) L151* probably null Het
Trappc12 T A 12: 28,742,512 (GRCm39) I682L possibly damaging Het
Trav6d-4 A C 14: 52,991,056 (GRCm39) T31P probably damaging Het
Trpm8 A G 1: 88,275,910 (GRCm39) T503A probably benign Het
Virma T A 4: 11,542,116 (GRCm39) Y1567* probably null Het
Vmn1r228 T A 17: 20,996,943 (GRCm39) K192* probably null Het
Zfp521 T A 18: 13,977,330 (GRCm39) T1028S possibly damaging Het
Zfp583 T A 7: 6,320,397 (GRCm39) Q205L probably benign Het
Other mutations in Rspo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Rspo3 APN 10 29,330,148 (GRCm39) critical splice donor site probably benign
IGL01726:Rspo3 APN 10 29,380,704 (GRCm39) missense probably benign 0.40
IGL02030:Rspo3 APN 10 29,376,044 (GRCm39) missense probably damaging 1.00
IGL02166:Rspo3 APN 10 29,411,275 (GRCm39) missense possibly damaging 0.86
IGL03078:Rspo3 APN 10 29,380,657 (GRCm39) missense probably damaging 1.00
IGL03412:Rspo3 APN 10 29,411,270 (GRCm39) missense possibly damaging 0.61
R0619:Rspo3 UTSW 10 29,380,633 (GRCm39) missense probably damaging 0.97
R0762:Rspo3 UTSW 10 29,375,917 (GRCm39) splice site probably benign
R0831:Rspo3 UTSW 10 29,330,253 (GRCm39) missense unknown
R4937:Rspo3 UTSW 10 29,382,524 (GRCm39) missense probably damaging 1.00
R5356:Rspo3 UTSW 10 29,376,064 (GRCm39) nonsense probably null
R6285:Rspo3 UTSW 10 29,375,926 (GRCm39) critical splice donor site probably null
R6606:Rspo3 UTSW 10 29,330,277 (GRCm39) missense unknown
R8502:Rspo3 UTSW 10 29,375,970 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCTGAGGGCTAAGTCTATGTG -3'
(R):5'- TGAATCTTATGTCCACAGTCTAACC -3'

Sequencing Primer
(F):5'- GCTAAGTCTATGTGTGTCTTTTCC -3'
(R):5'- GTCCACAGTCTAACCTCTCTTTTTG -3'
Posted On 2016-06-06