Incidental Mutation 'R5031:Tbc1d32'
ID 391702
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene Name TBC1 domain family, member 32
Synonyms D630037F22Rik, Bromi, b2b2284Clo, C6orf170
MMRRC Submission 042622-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R5031 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 55890389-56104785 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 55999627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 848 (Q848H)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
AlphaFold Q3URV1
Predicted Effect probably damaging
Transcript: ENSMUST00000099739
AA Change: Q848H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: Q848H

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,247,678 (GRCm39) N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 (GRCm39) K231R probably damaging Het
Ank1 C T 8: 23,589,696 (GRCm39) P599L probably damaging Het
Arhgef19 A G 4: 140,978,121 (GRCm39) E580G probably damaging Het
Atr A G 9: 95,747,755 (GRCm39) K346E probably damaging Het
AU021092 T C 16: 5,030,468 (GRCm39) K309E probably damaging Het
Baz2b T C 2: 59,743,151 (GRCm39) R1607G probably benign Het
Cct8 C T 16: 87,284,426 (GRCm39) V254M probably damaging Het
Cdca2 T A 14: 67,950,602 (GRCm39) I110F probably damaging Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Dmkn A G 7: 30,463,661 (GRCm39) I105V probably benign Het
Dock1 A G 7: 134,753,975 (GRCm39) D1584G probably benign Het
Epg5 G A 18: 78,072,163 (GRCm39) V2392I probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gsap G A 5: 21,447,824 (GRCm39) S294N possibly damaging Het
Hectd2 A G 19: 36,577,004 (GRCm39) N142D probably damaging Het
Hmcn1 A G 1: 150,464,008 (GRCm39) C5091R probably damaging Het
Ifitm5 G A 7: 140,530,017 (GRCm39) R36* probably null Het
Ints2 G A 11: 86,147,026 (GRCm39) P40L probably damaging Het
Irs1 A T 1: 82,264,688 (GRCm39) L1176* probably null Het
Klhl29 C T 12: 5,141,334 (GRCm39) R550Q probably benign Het
Kyat1 A G 2: 30,078,102 (GRCm39) M134T probably damaging Het
Lrrk2 A T 15: 91,584,822 (GRCm39) N384Y possibly damaging Het
Magel2 T C 7: 62,029,852 (GRCm39) S919P unknown Het
Mettl16 A T 11: 74,693,825 (GRCm39) I279F probably benign Het
Mmut T C 17: 41,249,718 (GRCm39) F231S possibly damaging Het
Mrgpra1 A T 7: 46,984,985 (GRCm39) Y231* probably null Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mvp A C 7: 126,592,788 (GRCm39) Y374* probably null Het
Nabp2 G A 10: 128,245,497 (GRCm39) probably benign Het
Nos1 C T 5: 118,017,378 (GRCm39) P247L probably benign Het
Or10ag53 C A 2: 87,082,426 (GRCm39) F48L probably benign Het
Or9g4b T A 2: 85,616,062 (GRCm39) L69* probably null Het
Pik3cb C T 9: 98,953,461 (GRCm39) D441N probably damaging Het
Qrich1 C T 9: 108,418,935 (GRCm39) P464S possibly damaging Het
Rab17 A T 1: 90,887,860 (GRCm39) probably null Het
Relch A G 1: 105,592,239 (GRCm39) N136S probably damaging Het
Rspo3 A T 10: 29,382,443 (GRCm39) L77H probably damaging Het
Spn G T 7: 126,736,402 (GRCm39) T35K probably benign Het
Sult1d1 T A 5: 87,707,703 (GRCm39) Y139F possibly damaging Het
Tcaf3 A G 6: 42,573,867 (GRCm39) V115A probably benign Het
Tram1l1 T A 3: 124,115,293 (GRCm39) L151* probably null Het
Trappc12 T A 12: 28,742,512 (GRCm39) I682L possibly damaging Het
Trav6d-4 A C 14: 52,991,056 (GRCm39) T31P probably damaging Het
Trpm8 A G 1: 88,275,910 (GRCm39) T503A probably benign Het
Virma T A 4: 11,542,116 (GRCm39) Y1567* probably null Het
Vmn1r228 T A 17: 20,996,943 (GRCm39) K192* probably null Het
Zfp521 T A 18: 13,977,330 (GRCm39) T1028S possibly damaging Het
Zfp583 T A 7: 6,320,397 (GRCm39) Q205L probably benign Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56,031,861 (GRCm39) missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56,091,221 (GRCm39) splice site probably benign
IGL00835:Tbc1d32 APN 10 55,965,942 (GRCm39) splice site probably benign
IGL01013:Tbc1d32 APN 10 56,078,055 (GRCm39) splice site probably null
IGL01306:Tbc1d32 APN 10 56,056,620 (GRCm39) missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56,091,176 (GRCm39) missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 55,999,673 (GRCm39) missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56,027,871 (GRCm39) missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 55,964,499 (GRCm39) missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56,100,715 (GRCm39) missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56,074,638 (GRCm39) missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56,074,587 (GRCm39) missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 55,893,799 (GRCm39) missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56,056,620 (GRCm39) missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56,074,535 (GRCm39) missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 55,893,701 (GRCm39) missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56,068,994 (GRCm39) missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56,050,059 (GRCm39) missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56,100,736 (GRCm39) missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56,056,672 (GRCm39) missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56,037,243 (GRCm39) missense probably benign
R1432:Tbc1d32 UTSW 10 55,893,758 (GRCm39) missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56,053,575 (GRCm39) splice site probably benign
R1708:Tbc1d32 UTSW 10 56,027,865 (GRCm39) missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 55,893,700 (GRCm39) missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 55,999,633 (GRCm39) nonsense probably null
R2208:Tbc1d32 UTSW 10 56,026,888 (GRCm39) critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56,050,011 (GRCm39) missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56,005,189 (GRCm39) missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56,100,676 (GRCm39) missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 55,925,867 (GRCm39) missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56,047,000 (GRCm39) missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56,100,745 (GRCm39) missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56,072,932 (GRCm39) missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 55,925,125 (GRCm39) splice site probably null
R5036:Tbc1d32 UTSW 10 56,071,500 (GRCm39) nonsense probably null
R5276:Tbc1d32 UTSW 10 56,027,914 (GRCm39) missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56,047,033 (GRCm39) missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 55,904,089 (GRCm39) missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 55,916,246 (GRCm39) missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56,071,571 (GRCm39) missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56,005,246 (GRCm39) missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56,026,973 (GRCm39) missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 55,964,489 (GRCm39) missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56,091,158 (GRCm39) missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 55,964,433 (GRCm39) missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56,038,304 (GRCm39) missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56,026,979 (GRCm39) missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56,071,525 (GRCm39) missense probably benign
R6422:Tbc1d32 UTSW 10 55,904,157 (GRCm39) nonsense probably null
R6508:Tbc1d32 UTSW 10 56,100,786 (GRCm39) missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56,056,626 (GRCm39) missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56,027,907 (GRCm39) nonsense probably null
R7012:Tbc1d32 UTSW 10 56,100,820 (GRCm39) missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56,074,537 (GRCm39) missense probably benign
R7288:Tbc1d32 UTSW 10 55,927,483 (GRCm39) critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56,027,929 (GRCm39) missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 55,904,173 (GRCm39) missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56,072,688 (GRCm39) missense possibly damaging 0.93
R8864:Tbc1d32 UTSW 10 55,963,655 (GRCm39) missense probably benign 0.01
R9018:Tbc1d32 UTSW 10 55,948,693 (GRCm39) missense probably benign 0.02
R9030:Tbc1d32 UTSW 10 56,037,241 (GRCm39) missense possibly damaging 0.92
R9530:Tbc1d32 UTSW 10 56,072,507 (GRCm39) missense probably damaging 0.98
R9616:Tbc1d32 UTSW 10 56,037,246 (GRCm39) missense possibly damaging 0.85
Z1188:Tbc1d32 UTSW 10 56,046,977 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAACCCACCTTAGCACTTTCTAGG -3'
(R):5'- CCAGGGTGAATCCACGTTTTG -3'

Sequencing Primer
(F):5'- ATGAGGACTTGAGCCTCATCC -3'
(R):5'- CACGTTTTGGAGTCAGAAATTTAAG -3'
Posted On 2016-06-06