Incidental Mutation 'R5031:Ints2'
ID 391706
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 042622-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5031 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 86210681-86257575 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86256200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 40 (P40L)
Ref Sequence ENSEMBL: ENSMUSP00000116633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000132024] [ENSMUST00000136469] [ENSMUST00000139285]
AlphaFold Q80UK8
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: P40L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: P40L

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: P40L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: P40L

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130614
Predicted Effect probably damaging
Transcript: ENSMUST00000132024
AA Change: P40L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114859
Gene: ENSMUSG00000018068
AA Change: P40L

DomainStartEndE-ValueType
Pfam:INTS2 24 140 1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134883
Predicted Effect probably damaging
Transcript: ENSMUST00000136469
AA Change: P40L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116633
Gene: ENSMUSG00000018068
AA Change: P40L

DomainStartEndE-ValueType
Pfam:INTS2 24 98 6.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139285
AA Change: P40L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068
AA Change: P40L

DomainStartEndE-ValueType
Pfam:INTS2 24 190 1.4e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Meta Mutation Damage Score 0.9076 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,664,514 N136S probably damaging Het
Abca13 A T 11: 9,297,678 N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 K231R probably damaging Het
Ank1 C T 8: 23,099,680 P599L probably damaging Het
Arhgef19 A G 4: 141,250,810 E580G probably damaging Het
Atr A G 9: 95,865,702 K346E probably damaging Het
AU021092 T C 16: 5,212,604 K309E probably damaging Het
Baz2b T C 2: 59,912,807 R1607G probably benign Het
Cct8 C T 16: 87,487,538 V254M probably damaging Het
Cdca2 T A 14: 67,713,153 I110F probably damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Dmkn A G 7: 30,764,236 I105V probably benign Het
Dock1 A G 7: 135,152,246 D1584G probably benign Het
Epg5 G A 18: 78,028,948 V2392I probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsap G A 5: 21,242,826 S294N possibly damaging Het
Hectd2 A G 19: 36,599,604 N142D probably damaging Het
Hmcn1 A G 1: 150,588,257 C5091R probably damaging Het
Ifitm5 G A 7: 140,950,104 R36* probably null Het
Irs1 A T 1: 82,286,967 L1176* probably null Het
Klhl29 C T 12: 5,091,334 R550Q probably benign Het
Kyat1 A G 2: 30,188,090 M134T probably damaging Het
Lrrk2 A T 15: 91,700,619 N384Y possibly damaging Het
Magel2 T C 7: 62,380,104 S919P unknown Het
Mettl16 A T 11: 74,802,999 I279F probably benign Het
Mrgpra1 A T 7: 47,335,237 Y231* probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mut T C 17: 40,938,827 F231S possibly damaging Het
Mvp A C 7: 126,993,616 Y374* probably null Het
Nabp2 G A 10: 128,409,628 probably benign Het
Nos1 C T 5: 117,879,313 P247L probably benign Het
Olfr1015 T A 2: 85,785,718 L69* probably null Het
Olfr1115 C A 2: 87,252,082 F48L probably benign Het
Pik3cb C T 9: 99,071,408 D441N probably damaging Het
Qrich1 C T 9: 108,541,736 P464S possibly damaging Het
Rab17 A T 1: 90,960,138 probably null Het
Rspo3 A T 10: 29,506,447 L77H probably damaging Het
Spn G T 7: 127,137,230 T35K probably benign Het
Sult1d1 T A 5: 87,559,844 Y139F possibly damaging Het
Tbc1d32 C A 10: 56,123,531 Q848H probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tram1l1 T A 3: 124,321,644 L151* probably null Het
Trappc12 T A 12: 28,692,513 I682L possibly damaging Het
Trav6d-4 A C 14: 52,753,599 T31P probably damaging Het
Trpm8 A G 1: 88,348,188 T503A probably benign Het
Virma T A 4: 11,542,116 Y1567* probably null Het
Vmn1r228 T A 17: 20,776,681 K192* probably null Het
Zfp521 T A 18: 13,844,273 T1028S possibly damaging Het
Zfp583 T A 7: 6,317,398 Q205L probably benign Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
R7337:Ints2 UTSW 11 86217842 missense probably benign 0.00
R7410:Ints2 UTSW 11 86233226 missense probably benign 0.02
R7483:Ints2 UTSW 11 86215618 missense probably damaging 1.00
R7503:Ints2 UTSW 11 86232055 missense probably benign
R7804:Ints2 UTSW 11 86212663 missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86238263 missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86213062 missense probably damaging 0.99
R7918:Ints2 UTSW 11 86222217 missense probably damaging 1.00
R7922:Ints2 UTSW 11 86244627 missense probably benign 0.29
R8058:Ints2 UTSW 11 86255353 missense probably benign 0.05
R8134:Ints2 UTSW 11 86212660 missense probably damaging 1.00
R8189:Ints2 UTSW 11 86215570 missense probably damaging 1.00
R8295:Ints2 UTSW 11 86225088 missense probably damaging 0.97
R8348:Ints2 UTSW 11 86255423 missense probably benign
R8448:Ints2 UTSW 11 86255423 missense probably benign
R8784:Ints2 UTSW 11 86222137 missense probably damaging 1.00
R8784:Ints2 UTSW 11 86225115 nonsense probably null
R8942:Ints2 UTSW 11 86212894 missense probably benign 0.00
R9037:Ints2 UTSW 11 86215704 missense probably benign
R9154:Ints2 UTSW 11 86234698 missense probably damaging 1.00
R9397:Ints2 UTSW 11 86244485 missense probably benign 0.01
R9412:Ints2 UTSW 11 86226763 missense probably damaging 0.99
R9472:Ints2 UTSW 11 86242998 missense
R9476:Ints2 UTSW 11 86244509 missense probably benign
R9510:Ints2 UTSW 11 86244509 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGAACTTTACCTAAGCTGCTG -3'
(R):5'- TGCCAATGCAAGGACCTAC -3'

Sequencing Primer
(F):5'- ACCTAAGCTGCTGTTCTTTGCTG -3'
(R):5'- TCATATATGTGGGAAGTAGATACCG -3'
Posted On 2016-06-06