Incidental Mutation 'R5031:Klhl29'
ID 391707
Institutional Source Beutler Lab
Gene Symbol Klhl29
Ensembl Gene ENSMUSG00000020627
Gene Name kelch-like 29
Synonyms Kbtbd9, A230106N14Rik
MMRRC Submission 042622-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R5031 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 5127472-5425682 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5141334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 550 (R550Q)
Ref Sequence ENSEMBL: ENSMUSP00000151284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]
AlphaFold Q80T74
Predicted Effect probably benign
Transcript: ENSMUST00000020958
AA Change: R550Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: R550Q

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 50 75 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
BTB 329 431 2.07e-22 SMART
BACK 436 538 4.88e-32 SMART
Kelch 585 636 5.33e0 SMART
Kelch 637 683 5.42e-5 SMART
Kelch 684 730 5.42e-5 SMART
Kelch 731 778 5.44e-1 SMART
Kelch 779 821 2.54e-1 SMART
Kelch 822 870 4.01e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218384
AA Change: R550Q

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,247,678 (GRCm39) N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 (GRCm39) K231R probably damaging Het
Ank1 C T 8: 23,589,696 (GRCm39) P599L probably damaging Het
Arhgef19 A G 4: 140,978,121 (GRCm39) E580G probably damaging Het
Atr A G 9: 95,747,755 (GRCm39) K346E probably damaging Het
AU021092 T C 16: 5,030,468 (GRCm39) K309E probably damaging Het
Baz2b T C 2: 59,743,151 (GRCm39) R1607G probably benign Het
Cct8 C T 16: 87,284,426 (GRCm39) V254M probably damaging Het
Cdca2 T A 14: 67,950,602 (GRCm39) I110F probably damaging Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Dmkn A G 7: 30,463,661 (GRCm39) I105V probably benign Het
Dock1 A G 7: 134,753,975 (GRCm39) D1584G probably benign Het
Epg5 G A 18: 78,072,163 (GRCm39) V2392I probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gsap G A 5: 21,447,824 (GRCm39) S294N possibly damaging Het
Hectd2 A G 19: 36,577,004 (GRCm39) N142D probably damaging Het
Hmcn1 A G 1: 150,464,008 (GRCm39) C5091R probably damaging Het
Ifitm5 G A 7: 140,530,017 (GRCm39) R36* probably null Het
Ints2 G A 11: 86,147,026 (GRCm39) P40L probably damaging Het
Irs1 A T 1: 82,264,688 (GRCm39) L1176* probably null Het
Kyat1 A G 2: 30,078,102 (GRCm39) M134T probably damaging Het
Lrrk2 A T 15: 91,584,822 (GRCm39) N384Y possibly damaging Het
Magel2 T C 7: 62,029,852 (GRCm39) S919P unknown Het
Mettl16 A T 11: 74,693,825 (GRCm39) I279F probably benign Het
Mmut T C 17: 41,249,718 (GRCm39) F231S possibly damaging Het
Mrgpra1 A T 7: 46,984,985 (GRCm39) Y231* probably null Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mvp A C 7: 126,592,788 (GRCm39) Y374* probably null Het
Nabp2 G A 10: 128,245,497 (GRCm39) probably benign Het
Nos1 C T 5: 118,017,378 (GRCm39) P247L probably benign Het
Or10ag53 C A 2: 87,082,426 (GRCm39) F48L probably benign Het
Or9g4b T A 2: 85,616,062 (GRCm39) L69* probably null Het
Pik3cb C T 9: 98,953,461 (GRCm39) D441N probably damaging Het
Qrich1 C T 9: 108,418,935 (GRCm39) P464S possibly damaging Het
Rab17 A T 1: 90,887,860 (GRCm39) probably null Het
Relch A G 1: 105,592,239 (GRCm39) N136S probably damaging Het
Rspo3 A T 10: 29,382,443 (GRCm39) L77H probably damaging Het
Spn G T 7: 126,736,402 (GRCm39) T35K probably benign Het
Sult1d1 T A 5: 87,707,703 (GRCm39) Y139F possibly damaging Het
Tbc1d32 C A 10: 55,999,627 (GRCm39) Q848H probably damaging Het
Tcaf3 A G 6: 42,573,867 (GRCm39) V115A probably benign Het
Tram1l1 T A 3: 124,115,293 (GRCm39) L151* probably null Het
Trappc12 T A 12: 28,742,512 (GRCm39) I682L possibly damaging Het
Trav6d-4 A C 14: 52,991,056 (GRCm39) T31P probably damaging Het
Trpm8 A G 1: 88,275,910 (GRCm39) T503A probably benign Het
Virma T A 4: 11,542,116 (GRCm39) Y1567* probably null Het
Vmn1r228 T A 17: 20,996,943 (GRCm39) K192* probably null Het
Zfp521 T A 18: 13,977,330 (GRCm39) T1028S possibly damaging Het
Zfp583 T A 7: 6,320,397 (GRCm39) Q205L probably benign Het
Other mutations in Klhl29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Klhl29 APN 12 5,190,705 (GRCm39) missense probably benign 0.01
IGL02639:Klhl29 APN 12 5,187,453 (GRCm39) missense probably damaging 0.96
IGL03142:Klhl29 APN 12 5,187,603 (GRCm39) missense probably damaging 1.00
bauxite UTSW 12 5,141,347 (GRCm39) missense probably damaging 0.98
Kerosene UTSW 12 5,141,030 (GRCm39) missense probably damaging 0.98
Mineral UTSW 12 5,133,995 (GRCm39) missense probably damaging 0.99
tungsten UTSW 12 5,140,995 (GRCm39) nonsense probably null
N/A - 535:Klhl29 UTSW 12 5,134,019 (GRCm39) missense probably damaging 1.00
R0347:Klhl29 UTSW 12 5,134,354 (GRCm39) missense probably damaging 0.97
R0622:Klhl29 UTSW 12 5,131,224 (GRCm39) missense probably damaging 1.00
R0631:Klhl29 UTSW 12 5,144,883 (GRCm39) missense probably benign 0.08
R0784:Klhl29 UTSW 12 5,131,251 (GRCm39) missense probably damaging 1.00
R1157:Klhl29 UTSW 12 5,140,650 (GRCm39) missense possibly damaging 0.89
R1521:Klhl29 UTSW 12 5,141,307 (GRCm39) missense probably damaging 1.00
R1535:Klhl29 UTSW 12 5,134,486 (GRCm39) missense probably damaging 1.00
R1599:Klhl29 UTSW 12 5,143,538 (GRCm39) missense probably damaging 1.00
R2049:Klhl29 UTSW 12 5,187,876 (GRCm39) missense probably damaging 0.96
R2568:Klhl29 UTSW 12 5,141,350 (GRCm39) missense probably damaging 0.96
R2883:Klhl29 UTSW 12 5,134,036 (GRCm39) missense probably damaging 1.00
R3724:Klhl29 UTSW 12 5,140,603 (GRCm39) missense probably damaging 0.99
R3951:Klhl29 UTSW 12 5,190,660 (GRCm39) missense probably damaging 1.00
R5078:Klhl29 UTSW 12 5,143,530 (GRCm39) missense possibly damaging 0.82
R5410:Klhl29 UTSW 12 5,141,366 (GRCm39) missense probably benign 0.36
R5619:Klhl29 UTSW 12 5,190,587 (GRCm39) missense probably benign 0.23
R5681:Klhl29 UTSW 12 5,140,669 (GRCm39) missense possibly damaging 0.56
R6028:Klhl29 UTSW 12 5,140,995 (GRCm39) nonsense probably null
R6294:Klhl29 UTSW 12 5,133,995 (GRCm39) missense probably damaging 0.99
R6394:Klhl29 UTSW 12 5,187,720 (GRCm39) missense probably benign 0.00
R6394:Klhl29 UTSW 12 5,144,830 (GRCm39) nonsense probably null
R6475:Klhl29 UTSW 12 5,141,030 (GRCm39) missense probably damaging 0.98
R6737:Klhl29 UTSW 12 5,260,124 (GRCm39) missense possibly damaging 0.68
R6781:Klhl29 UTSW 12 5,141,347 (GRCm39) missense probably damaging 0.98
R6788:Klhl29 UTSW 12 5,134,393 (GRCm39) missense probably damaging 1.00
R7741:Klhl29 UTSW 12 5,187,500 (GRCm39) missense possibly damaging 0.49
R8709:Klhl29 UTSW 12 5,140,681 (GRCm39) missense probably damaging 1.00
R8886:Klhl29 UTSW 12 5,187,542 (GRCm39) missense possibly damaging 0.48
R8888:Klhl29 UTSW 12 5,187,542 (GRCm39) missense possibly damaging 0.48
R8954:Klhl29 UTSW 12 5,187,542 (GRCm39) missense possibly damaging 0.48
R8971:Klhl29 UTSW 12 5,190,710 (GRCm39) critical splice acceptor site probably null
R9031:Klhl29 UTSW 12 5,140,537 (GRCm39) missense probably damaging 1.00
R9066:Klhl29 UTSW 12 5,260,114 (GRCm39) missense probably benign 0.01
R9432:Klhl29 UTSW 12 5,260,056 (GRCm39) missense probably benign 0.00
R9509:Klhl29 UTSW 12 5,190,629 (GRCm39) missense probably damaging 0.98
R9733:Klhl29 UTSW 12 5,190,641 (GRCm39) missense probably damaging 1.00
Z1177:Klhl29 UTSW 12 5,131,152 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TCAGCATCTGTGTCTGGATCC -3'
(R):5'- TGTCTAGTATGCCAGGCTGG -3'

Sequencing Primer
(F):5'- TCTGGATCCTCTCTGGGGAGAC -3'
(R):5'- CAGATGGGGAGTCCTTCTCTATTCAG -3'
Posted On 2016-06-06