Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Klhl29'

391707

Institutional Source

Beutler Lab

Gene Symbol

Klhl29

Ensembl Gene

ENSMUSG00000020627

Gene Name

kelch-like 29

Synonyms

A230106N14Rik, Kbtbd9

MMRRC Submission

042622-MU

Accession Numbers

Genbank: NM_001164493; MGI: 2683857

Essential gene?

Probably non essential (E-score: 0.181) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5077472-5375682 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5091334 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 550 (R550Q)

Ref Sequence

ENSEMBL: ENSMUSP00000151284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]

AlphaFold

Q80T74

Predicted Effect

probably benign
Transcript: ENSMUST00000020958
AA Change: R550Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: R550Q

Domain	Start	End	E-Value	Type
low complexity region	30	49	N/A	INTRINSIC
low complexity region	50	75	N/A	INTRINSIC
low complexity region	80	94	N/A	INTRINSIC
low complexity region	205	219	N/A	INTRINSIC
low complexity region	260	280	N/A	INTRINSIC
BTB	329	431	2.07e-22	SMART
BACK	436	538	4.88e-32	SMART
Kelch	585	636	5.33e0	SMART
Kelch	637	683	5.42e-5	SMART
Kelch	684	730	5.42e-5	SMART
Kelch	731	778	5.44e-1	SMART
Kelch	779	821	2.54e-1	SMART
Kelch	822	870	4.01e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218384
AA Change: R550Q

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

Meta Mutation Damage Score

0.1176

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Klhl29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Klhl29	APN	12	5140705	missense	probably benign	0.01
IGL02639:Klhl29	APN	12	5137453	missense	probably damaging	0.96
IGL03142:Klhl29	APN	12	5137603	missense	probably damaging	1.00
bauxite	UTSW	12	5091347	missense	probably damaging	0.98
Kerosene	UTSW	12	5091030	missense	probably damaging	0.98
Mineral	UTSW	12	5083995	missense	probably damaging	0.99
tungsten	UTSW	12	5090995	nonsense	probably null
N/A - 535:Klhl29	UTSW	12	5084019	missense	probably damaging	1.00
R0347:Klhl29	UTSW	12	5084354	missense	probably damaging	0.97
R0622:Klhl29	UTSW	12	5081224	missense	probably damaging	1.00
R0631:Klhl29	UTSW	12	5094883	missense	probably benign	0.08
R0784:Klhl29	UTSW	12	5081251	missense	probably damaging	1.00
R1157:Klhl29	UTSW	12	5090650	missense	possibly damaging	0.89
R1521:Klhl29	UTSW	12	5091307	missense	probably damaging	1.00
R1535:Klhl29	UTSW	12	5084486	missense	probably damaging	1.00
R1599:Klhl29	UTSW	12	5093538	missense	probably damaging	1.00
R2049:Klhl29	UTSW	12	5137876	missense	probably damaging	0.96
R2568:Klhl29	UTSW	12	5091350	missense	probably damaging	0.96
R2883:Klhl29	UTSW	12	5084036	missense	probably damaging	1.00
R3724:Klhl29	UTSW	12	5090603	missense	probably damaging	0.99
R3951:Klhl29	UTSW	12	5140660	missense	probably damaging	1.00
R5078:Klhl29	UTSW	12	5093530	missense	possibly damaging	0.82
R5410:Klhl29	UTSW	12	5091366	missense	probably benign	0.36
R5619:Klhl29	UTSW	12	5140587	missense	probably benign	0.23
R5681:Klhl29	UTSW	12	5090669	missense	possibly damaging	0.56
R6028:Klhl29	UTSW	12	5090995	nonsense	probably null
R6294:Klhl29	UTSW	12	5083995	missense	probably damaging	0.99
R6394:Klhl29	UTSW	12	5094830	nonsense	probably null
R6394:Klhl29	UTSW	12	5137720	missense	probably benign	0.00
R6475:Klhl29	UTSW	12	5091030	missense	probably damaging	0.98
R6737:Klhl29	UTSW	12	5210124	missense	possibly damaging	0.68
R6781:Klhl29	UTSW	12	5091347	missense	probably damaging	0.98
R6788:Klhl29	UTSW	12	5084393	missense	probably damaging	1.00
R7741:Klhl29	UTSW	12	5137500	missense	possibly damaging	0.49
R8709:Klhl29	UTSW	12	5090681	missense	probably damaging	1.00
R8886:Klhl29	UTSW	12	5137542	missense	possibly damaging	0.48
R8888:Klhl29	UTSW	12	5137542	missense	possibly damaging	0.48
R8954:Klhl29	UTSW	12	5137542	missense	possibly damaging	0.48
R8971:Klhl29	UTSW	12	5140710	critical splice acceptor site	probably null
R9031:Klhl29	UTSW	12	5090537	missense	probably damaging	1.00
R9066:Klhl29	UTSW	12	5210114	missense	probably benign	0.01
R9432:Klhl29	UTSW	12	5210056	missense	probably benign	0.00
R9509:Klhl29	UTSW	12	5140629	missense	probably damaging	0.98
R9733:Klhl29	UTSW	12	5140641	missense	probably damaging	1.00
Z1177:Klhl29	UTSW	12	5081152	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGCATCTGTGTCTGGATCC -3'
(R):5'- TGTCTAGTATGCCAGGCTGG -3'

Sequencing Primer
(F):5'- TCTGGATCCTCTCTGGGGAGAC -3'
(R):5'- CAGATGGGGAGTCCTTCTCTATTCAG -3'

Posted On

2016-06-06