Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Trappc12'

391708

Institutional Source

Beutler Lab

Gene Symbol

Trappc12

Ensembl Gene

ENSMUSG00000020628

Gene Name

trafficking protein particle complex 12

Synonyms

Ttc15, D930014A20Rik, CGI-87

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.456) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28690628-28750472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28692513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 682 (I682L)

Ref Sequence

ENSEMBL: ENSMUSP00000127752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020954] [ENSMUST00000168129]

AlphaFold

Q8K2L8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020954
AA Change: I682L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020954
Gene: ENSMUSG00000020628
AA Change: I682L

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC
low complexity region	183	196	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
TPR	607	640	3.67e-3	SMART
TPR	642	675	1.44e1	SMART
TPR	682	715	3.37e-2	SMART
TPR	716	749	2.99e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168129
AA Change: I682L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127752
Gene: ENSMUSG00000020628
AA Change: I682L

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC
low complexity region	183	196	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
TPR	607	640	3.67e-3	SMART
TPR	642	675	1.44e1	SMART
TPR	682	715	3.37e-2	SMART
TPR	716	749	2.99e1	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Trappc12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Trappc12	APN	12	28737836	missense	probably damaging	0.99
IGL01018:Trappc12	APN	12	28691854	splice site	probably benign
IGL01295:Trappc12	APN	12	28746762	missense	probably damaging	1.00
IGL01365:Trappc12	APN	12	28747402	missense	probably damaging	1.00
IGL01490:Trappc12	APN	12	28746915	missense	probably damaging	1.00
IGL01975:Trappc12	APN	12	28692492	critical splice donor site	probably null
IGL02851:Trappc12	APN	12	28691406	missense	probably damaging	0.98
IGL02885:Trappc12	APN	12	28747014	missense	probably benign
IGL03163:Trappc12	APN	12	28746654	missense	probably damaging	1.00
R0102:Trappc12	UTSW	12	28746752	missense	probably damaging	1.00
R0102:Trappc12	UTSW	12	28746752	missense	probably damaging	1.00
R0330:Trappc12	UTSW	12	28747260	missense	probably benign	0.00
R0517:Trappc12	UTSW	12	28697134	splice site	probably benign
R0837:Trappc12	UTSW	12	28703597	missense	possibly damaging	0.92
R1439:Trappc12	UTSW	12	28747161	missense	possibly damaging	0.96
R1477:Trappc12	UTSW	12	28737752	missense	probably benign	0.25
R1651:Trappc12	UTSW	12	28691777	missense	probably benign	0.32
R1899:Trappc12	UTSW	12	28746985	missense	probably damaging	0.97
R1900:Trappc12	UTSW	12	28746985	missense	probably damaging	0.97
R2133:Trappc12	UTSW	12	28746598	missense	probably benign	0.00
R2174:Trappc12	UTSW	12	28747381	missense	possibly damaging	0.94
R4449:Trappc12	UTSW	12	28747235	missense	probably benign	0.05
R5209:Trappc12	UTSW	12	28737794	missense	probably benign	0.03
R5220:Trappc12	UTSW	12	28746697	missense	probably damaging	0.97
R5458:Trappc12	UTSW	12	28746390	missense	probably damaging	0.98
R5471:Trappc12	UTSW	12	28691500	missense	probably damaging	1.00
R5482:Trappc12	UTSW	12	28691325	missense	probably damaging	0.97
R5808:Trappc12	UTSW	12	28746864	missense	probably damaging	1.00
R5916:Trappc12	UTSW	12	28691514	missense	probably damaging	1.00
R5996:Trappc12	UTSW	12	28747114	missense	possibly damaging	0.83
R6378:Trappc12	UTSW	12	28747083	missense	probably damaging	0.97
R7669:Trappc12	UTSW	12	28711958	missense	probably benign	0.30
R9233:Trappc12	UTSW	12	28722415	missense	possibly damaging	0.88
R9323:Trappc12	UTSW	12	28692492	critical splice donor site	probably null
R9361:Trappc12	UTSW	12	28746418	missense	probably damaging	0.99
R9550:Trappc12	UTSW	12	28711986	critical splice acceptor site	probably null
R9784:Trappc12	UTSW	12	28747458	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- TGAGATGGCTCAGCAGGTTG -3'
(R):5'- TTCCTCTTCTGACATGATACTGGG -3'

Sequencing Primer
(F):5'- CACAAAGCTGCTGGGGTTCATG -3'
(R):5'- CTTCTGACATGATACTGGGAACAAC -3'

Posted On

2016-06-06