Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Gm4787'

391709

Institutional Source

Beutler Lab

Gene Symbol

Gm4787

Ensembl Gene

ENSMUSG00000072974

Gene Name

predicted gene 4787

Synonyms

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81376991-81379464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 81377830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 518 (T518S)

Ref Sequence

ENSEMBL: ENSMUSP00000077390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]

AlphaFold

B2RUD9

Predicted Effect

probably benign
Transcript: ENSMUST00000062182
AA Change: T518S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: T518S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	46	163	1.5e-19	PFAM
Pfam:Reprolysin	213	406	4.6e-18	PFAM
DISIN	425	500	2e-33	SMART
ACR	501	644	2.83e-53	SMART
transmembrane domain	714	736	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000087222

Predicted Effect

probably benign
Transcript: ENSMUST00000110340

SMART Domains

Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	74	6.6e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164386

SMART Domains

Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

Domain	Start	End	E-Value	Type
PDZ	21	100	6.16e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166723

SMART Domains

Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	73	6.9e-16	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Gm4787

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01719:Gm4787	APN	12	81377174	missense	possibly damaging	0.50
IGL01916:Gm4787	APN	12	81377444	missense	probably benign	0.36
IGL02193:Gm4787	APN	12	81378528	missense	probably benign	0.02
IGL02623:Gm4787	APN	12	81378728	missense	probably damaging	1.00
IGL02681:Gm4787	APN	12	81378769	missense	possibly damaging	0.88
IGL03257:Gm4787	APN	12	81378052	missense	probably damaging	1.00
IGL03410:Gm4787	APN	12	81379174	missense	probably damaging	1.00
F5770:Gm4787	UTSW	12	81377567	nonsense	probably null
PIT4362001:Gm4787	UTSW	12	81377175	missense	probably benign
R0070:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R0128:Gm4787	UTSW	12	81377747	nonsense	probably null
R0220:Gm4787	UTSW	12	81378648	missense	probably damaging	0.98
R0304:Gm4787	UTSW	12	81378934	missense	probably damaging	1.00
R0513:Gm4787	UTSW	12	81378312	missense	probably benign	0.03
R1761:Gm4787	UTSW	12	81377176	missense	probably benign	0.02
R1809:Gm4787	UTSW	12	81378529	missense	possibly damaging	0.91
R1853:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R1854:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R2030:Gm4787	UTSW	12	81378770	missense	probably damaging	1.00
R2063:Gm4787	UTSW	12	81378920	missense	probably benign	0.39
R2112:Gm4787	UTSW	12	81377833	missense	probably damaging	1.00
R2140:Gm4787	UTSW	12	81378562	missense	probably benign	0.03
R2151:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2152:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2342:Gm4787	UTSW	12	81378758	missense	possibly damaging	0.91
R2504:Gm4787	UTSW	12	81379137	missense	possibly damaging	0.93
R4038:Gm4787	UTSW	12	81378358	missense	probably damaging	1.00
R4604:Gm4787	UTSW	12	81379213	missense	probably benign	0.17
R4748:Gm4787	UTSW	12	81378056	missense	probably damaging	1.00
R4750:Gm4787	UTSW	12	81378367	missense	possibly damaging	0.95
R4928:Gm4787	UTSW	12	81378838	missense	probably benign	0.03
R4960:Gm4787	UTSW	12	81379316	missense	probably damaging	0.99
R4974:Gm4787	UTSW	12	81377629	missense	probably damaging	0.99
R5028:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5029:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5098:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5099:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5100:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5101:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5135:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5152:Gm4787	UTSW	12	81378677	missense	probably benign	0.02
R5180:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5220:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5257:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5258:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5297:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5324:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5325:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5355:Gm4787	UTSW	12	81377465	nonsense	probably null
R5364:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5396:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5397:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5398:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5514:Gm4787	UTSW	12	81378328	missense	possibly damaging	0.90
R5634:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5666:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5670:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5787:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5788:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R6354:Gm4787	UTSW	12	81377981	missense	probably damaging	1.00
R6932:Gm4787	UTSW	12	81379200	missense	probably benign	0.04
R7120:Gm4787	UTSW	12	81378486	missense	probably benign	0.00
R7237:Gm4787	UTSW	12	81377668	missense	probably damaging	0.99
R7937:Gm4787	UTSW	12	81377905	missense	probably benign	0.01
R8022:Gm4787	UTSW	12	81377720	missense	possibly damaging	0.94
R8140:Gm4787	UTSW	12	81378151	missense	probably benign	0.00
R8314:Gm4787	UTSW	12	81379135	missense	probably damaging	1.00
R8480:Gm4787	UTSW	12	81377506	missense	probably damaging	1.00
R8498:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R8515:Gm4787	UTSW	12	81377269	missense	probably benign	0.00
R9103:Gm4787	UTSW	12	81378715	missense	probably benign	0.06
R9457:Gm4787	UTSW	12	81379246	missense	probably damaging	1.00
R9557:Gm4787	UTSW	12	81379300	nonsense	probably null
R9608:Gm4787	UTSW	12	81378312	missense	probably benign	0.03
V7580:Gm4787	UTSW	12	81377567	nonsense	probably null
V7581:Gm4787	UTSW	12	81377567	nonsense	probably null
V7582:Gm4787	UTSW	12	81377567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACGCTTGACACCATCACAG -3'
(R):5'- CAGGGCAGCTCTTGTAATAAAG -3'

Sequencing Primer
(F):5'- GCTTGACACCATCACAGTGGAG -3'
(R):5'- CAGCTCTTGTAATAAAGGAGGTTGC -3'

Posted On

2016-06-06