Incidental Mutation 'R5031:Mut'
ID391717
Institutional Source Beutler Lab
Gene Symbol Mut
Ensembl Gene ENSMUSG00000023921
Gene Namemethylmalonyl-Coenzyme A mutase
Synonyms
MMRRC Submission 042622-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5031 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40934685-40961989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40938827 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 231 (F231S)
Ref Sequence ENSEMBL: ENSMUSP00000130941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087114] [ENSMUST00000169611]
Predicted Effect probably benign
Transcript: ENSMUST00000087114
SMART Domains Protein: ENSMUSP00000084353
Gene: ENSMUSG00000023919

DomainStartEndE-ValueType
Pfam:CENP-Q 118 268 7.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169611
AA Change: F231S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921
AA Change: F231S

DomainStartEndE-ValueType
Pfam:MM_CoA_mutase 60 572 3.7e-240 PFAM
Pfam:B12-binding 613 731 4.7e-17 PFAM
Meta Mutation Damage Score 0.8742 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,664,514 N136S probably damaging Het
Abca13 A T 11: 9,297,678 N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 K231R probably damaging Het
Ank1 C T 8: 23,099,680 P599L probably damaging Het
Arhgef19 A G 4: 141,250,810 E580G probably damaging Het
Atr A G 9: 95,865,702 K346E probably damaging Het
AU021092 T C 16: 5,212,604 K309E probably damaging Het
Baz2b T C 2: 59,912,807 R1607G probably benign Het
Cct8 C T 16: 87,487,538 V254M probably damaging Het
Cdca2 T A 14: 67,713,153 I110F probably damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Dmkn A G 7: 30,764,236 I105V probably benign Het
Dock1 A G 7: 135,152,246 D1584G probably benign Het
Epg5 G A 18: 78,028,948 V2392I probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsap G A 5: 21,242,826 S294N possibly damaging Het
Hectd2 A G 19: 36,599,604 N142D probably damaging Het
Hmcn1 A G 1: 150,588,257 C5091R probably damaging Het
Ifitm5 G A 7: 140,950,104 R36* probably null Het
Ints2 G A 11: 86,256,200 P40L probably damaging Het
Irs1 A T 1: 82,286,967 L1176* probably null Het
Klhl29 C T 12: 5,091,334 R550Q probably benign Het
Kyat1 A G 2: 30,188,090 M134T probably damaging Het
Lrrk2 A T 15: 91,700,619 N384Y possibly damaging Het
Magel2 T C 7: 62,380,104 S919P unknown Het
Mettl16 A T 11: 74,802,999 I279F probably benign Het
Mrgpra1 A T 7: 47,335,237 Y231* probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mvp A C 7: 126,993,616 Y374* probably null Het
Nabp2 G A 10: 128,409,628 probably benign Het
Nos1 C T 5: 117,879,313 P247L probably benign Het
Olfr1015 T A 2: 85,785,718 L69* probably null Het
Olfr1115 C A 2: 87,252,082 F48L probably benign Het
Pik3cb C T 9: 99,071,408 D441N probably damaging Het
Qrich1 C T 9: 108,541,736 P464S possibly damaging Het
Rab17 A T 1: 90,960,138 probably null Het
Rspo3 A T 10: 29,506,447 L77H probably damaging Het
Spn G T 7: 127,137,230 T35K probably benign Het
Sult1d1 T A 5: 87,559,844 Y139F possibly damaging Het
Tbc1d32 C A 10: 56,123,531 Q848H probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tram1l1 T A 3: 124,321,644 L151* probably null Het
Trappc12 T A 12: 28,692,513 I682L possibly damaging Het
Trav6d-4 A C 14: 52,753,599 T31P probably damaging Het
Trpm8 A G 1: 88,348,188 T503A probably benign Het
Virma T A 4: 11,542,116 Y1567* probably null Het
Vmn1r228 T A 17: 20,776,681 K192* probably null Het
Zfp521 T A 18: 13,844,273 T1028S possibly damaging Het
Zfp583 T A 7: 6,317,398 Q205L probably benign Het
Other mutations in Mut
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Mut APN 17 40956271 missense probably damaging 0.99
IGL01666:Mut APN 17 40958811 missense probably damaging 1.00
IGL02141:Mut APN 17 40938817 missense possibly damaging 0.68
IGL02257:Mut APN 17 40938734 missense possibly damaging 0.78
IGL02538:Mut APN 17 40938619 missense probably damaging 1.00
mix UTSW 17 40941383 missense possibly damaging 0.66
mongrel UTSW 17 40938731 missense possibly damaging 0.77
R0115:Mut UTSW 17 40956227 missense probably damaging 1.00
R0381:Mut UTSW 17 40937258 missense probably benign 0.04
R0603:Mut UTSW 17 40947166 missense probably damaging 0.99
R0928:Mut UTSW 17 40937283 missense probably benign 0.24
R1292:Mut UTSW 17 40941407 missense probably damaging 1.00
R1452:Mut UTSW 17 40937468 splice site probably benign
R1460:Mut UTSW 17 40937375 missense probably damaging 1.00
R2044:Mut UTSW 17 40941451 missense probably benign 0.00
R2256:Mut UTSW 17 40956319 missense probably benign 0.02
R2448:Mut UTSW 17 40958841 missense probably damaging 0.96
R3113:Mut UTSW 17 40958356 missense probably damaging 1.00
R3176:Mut UTSW 17 40958872 splice site probably null
R3276:Mut UTSW 17 40958872 splice site probably null
R3894:Mut UTSW 17 40955139 missense probably damaging 0.97
R4624:Mut UTSW 17 40947055 missense probably damaging 1.00
R4801:Mut UTSW 17 40937351 missense probably benign 0.08
R4802:Mut UTSW 17 40937351 missense probably benign 0.08
R5394:Mut UTSW 17 40947184 missense probably benign 0.02
R5651:Mut UTSW 17 40947111 missense probably damaging 1.00
R6225:Mut UTSW 17 40938731 missense possibly damaging 0.77
R6274:Mut UTSW 17 40956245 missense probably benign 0.00
R7002:Mut UTSW 17 40941383 missense possibly damaging 0.66
R7141:Mut UTSW 17 40952839 missense possibly damaging 0.68
R7203:Mut UTSW 17 40938673 missense probably benign 0.06
R7868:Mut UTSW 17 40947043 missense probably damaging 1.00
R8050:Mut UTSW 17 40943893 missense probably benign 0.06
R8228:Mut UTSW 17 40937328 missense possibly damaging 0.92
RF021:Mut UTSW 17 40951758 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGGAGTTGCTATTGACACTG -3'
(R):5'- CCATCTGAACTCTGAAGGGAAC -3'

Sequencing Primer
(F):5'- TGCTATTGACACTGTAGAAGACACC -3'
(R):5'- CATCTGAACTCTGAAGGGAACTAAGG -3'
Posted On2016-06-06