Incidental Mutation 'R5032:Myo3a'
ID391726
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Namemyosin IIIA
Synonyms9030416P08Rik
MMRRC Submission 042623-MU
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5032 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22227503-22618252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22282602 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 175 (L175P)
Ref Sequence ENSEMBL: ENSMUSP00000120573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]
Predicted Effect probably damaging
Transcript: ENSMUST00000044749
AA Change: L183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: L183P

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142435
Predicted Effect probably damaging
Transcript: ENSMUST00000153002
AA Change: L175P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: L175P

DomainStartEndE-ValueType
S_TKc 21 287 1.62e-91 SMART
MYSc 332 753 3.06e-35 SMART
Meta Mutation Damage Score 0.9375 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5346 T C 8: 43,626,471 N239D probably damaging Het
Gm5592 A G 7: 41,289,735 R814G probably damaging Het
Gmps A G 3: 63,990,325 K233E probably benign Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hc T C 2: 35,013,532 I1037V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Kifc3 A G 8: 95,102,726 S508P probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mta1 T A 12: 113,133,525 probably null Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3c2g A T 6: 139,896,202 T778S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CAGGGTCAGTCTGTATTTCAGC -3'
(R):5'- AGCTAATTTACCCTGAATCCCC -3'

Sequencing Primer
(F):5'- CAGTCTGTATTTCAGCTATATGGAC -3'
(R):5'- CAACACAGGAGACATTTTTCTTATGG -3'
Posted On2016-06-06