Incidental Mutation 'R5032:Hc'
ID391728
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 042623-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R5032 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35013532 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1037 (I1037V)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure
Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028233
AA Change: I1037V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: I1037V

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153559
Predicted Effect probably benign
Transcript: ENSMUST00000156412
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5346 T C 8: 43,626,471 N239D probably damaging Het
Gm5592 A G 7: 41,289,735 R814G probably damaging Het
Gmps A G 3: 63,990,325 K233E probably benign Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Kifc3 A G 8: 95,102,726 S508P probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mta1 T A 12: 113,133,525 probably null Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Myo3a T C 2: 22,282,602 L175P probably damaging Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3c2g A T 6: 139,896,202 T778S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 splice site probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7388:Hc UTSW 2 34984847 splice site probably null
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7599:Hc UTSW 2 35050419 missense probably damaging 1.00
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
R7853:Hc UTSW 2 35010033 missense probably damaging 1.00
R7877:Hc UTSW 2 34997399 nonsense probably null
R8375:Hc UTSW 2 34983719 missense probably benign 0.32
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Z1176:Hc UTSW 2 35006273 critical splice acceptor site probably null
Z1177:Hc UTSW 2 35013610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAAGTTAAGCCAAAATGCCTC -3'
(R):5'- GTTACGTCCACTTGGGTCTC -3'

Sequencing Primer
(F):5'- AAGAGAACATGCCGTGGTTTTTC -3'
(R):5'- CTTTTTCTTTCAGGACTGCTTGTAG -3'
Posted On2016-06-06