Mutagenetix > Incidental Mutation

Incidental Mutation 'R5032:Pla2g4d'

391730

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4d

Ensembl Gene

ENSMUSG00000070719

Gene Name

phospholipase A2, group IVD

Synonyms

Pla2delta, 2610311B01Rik

MMRRC Submission

042623-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R5032 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120265595-120289197 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 120281695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 118 (Y118*)

Ref Sequence

ENSEMBL: ENSMUSP00000092252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094665]

AlphaFold

Q50L43

Predicted Effect

probably null
Transcript: ENSMUST00000094665
AA Change: Y118*

SMART Domains

Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: Y118*

Domain	Start	End	E-Value	Type
C2	32	132	1.12e-18	SMART
PLAc	263	766	3.36e-11	SMART

Meta Mutation Damage Score

0.9699

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.0%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Actl9	A	G	17: 33,434,088	N374S	probably benign	Het
Ahcyl2	T	A	6: 29,768,556		probably benign	Het
Arfgef2	T	C	2: 166,878,544	M1501T	probably benign	Het
Asb17	A	T	3: 153,844,538	D69V	probably damaging	Het
Atp13a5	T	C	16: 29,263,450	Y877C	probably damaging	Het
Atrip	T	C	9: 109,065,203	Q64R	probably benign	Het
Auts2	A	G	5: 131,476,891		probably benign	Het
Cacna2d1	G	T	5: 16,359,070	R893L	probably damaging	Het
Ccdc138	C	T	10: 58,573,636	R596C	probably damaging	Het
Cd163	A	G	6: 124,311,669	Y353C	probably damaging	Het
Cdon	T	C	9: 35,489,034	Y1015H	probably damaging	Het
Chsy3	T	C	18: 59,179,471	Y339H	probably damaging	Het
Cspp1	T	C	1: 10,066,519	W190R	probably benign	Het
Ddx1	A	T	12: 13,223,992	I570N	probably damaging	Het
Duox1	G	A	2: 122,337,317	R1027H	probably benign	Het
Dync1h1	C	T	12: 110,626,892	Q1198*	probably null	Het
Ecel1	G	A	1: 87,154,253	S246L	probably damaging	Het
Fam228b	T	G	12: 4,763,042	R109S	probably damaging	Het
Fut9	T	A	4: 25,799,245		probably benign	Het
Gm5346	T	C	8: 43,626,471	N239D	probably damaging	Het
Gm5592	A	G	7: 41,289,735	R814G	probably damaging	Het
Gmps	A	G	3: 63,990,325	K233E	probably benign	Het
Gramd1c	A	G	16: 43,990,663	Y438H	probably damaging	Het
Gsdmc	A	T	15: 63,802,033	D134E	possibly damaging	Het
Gxylt2	A	G	6: 100,783,181	I226V	probably benign	Het
Hc	T	C	2: 35,013,532	I1037V	probably benign	Het
Hspa4	T	G	11: 53,289,123	R69S	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Kifc3	A	G	8: 95,102,726	S508P	probably damaging	Het
Krt7	G	A	15: 101,412,547	R25H	probably benign	Het
Lhfp	T	A	3: 53,043,433	S43T	possibly damaging	Het
Lrrc7	T	A	3: 158,181,580	K394N	possibly damaging	Het
Lypd4	A	T	7: 24,866,815	L28Q	probably damaging	Het
Mdc1	A	G	17: 35,850,589	E798G	probably benign	Het
Mta1	T	A	12: 113,133,525		probably null	Het
Mtg2	A	T	2: 180,083,390	Q132L	possibly damaging	Het
Myh1	G	T	11: 67,206,048	E382*	probably null	Het
Myo3a	T	C	2: 22,282,602	L175P	probably damaging	Het
Nckap5	A	T	1: 125,977,049	F144L	possibly damaging	Het
Nfrkb	T	A	9: 31,389,055		probably null	Het
Nmt2	C	T	2: 3,284,392	P5L	probably benign	Het
Nsmf	T	C	2: 25,055,061		probably null	Het
Olfr635	A	T	7: 103,979,374	M61L	probably damaging	Het
Olfr76	T	A	19: 12,120,056	I219F	probably benign	Het
Oprl1	C	T	2: 181,719,002	R257C	probably damaging	Het
Pcdhgc3	T	A	18: 37,807,585	N346K	probably damaging	Het
Pcnt	G	A	10: 76,355,077	P2791S	probably benign	Het
Pdia3	A	G	2: 121,414,139	N11S	probably benign	Het
Pik3c2g	A	T	6: 139,896,202	T778S	probably benign	Het
Pik3ip1	T	A	11: 3,333,520	I75N	probably damaging	Het
Ppargc1b	A	G	18: 61,307,265	S845P	probably damaging	Het
Prdm2	A	T	4: 143,179,367	L50*	probably null	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Pxdn	G	A	12: 30,003,141	V926I	probably benign	Het
Rab11fip2	A	T	19: 59,937,367	N139K	probably damaging	Het
Rcn2	T	A	9: 56,053,016	M189K	probably damaging	Het
Rev1	A	T	1: 38,074,489		probably benign	Het
Rhbg	C	A	3: 88,245,134	G368C	probably damaging	Het
Rnf214	A	G	9: 45,899,744		probably null	Het
Sf3a3	T	C	4: 124,725,166	S307P	probably benign	Het
Slc6a18	T	A	13: 73,666,323	Y494F	probably damaging	Het
Son	T	C	16: 91,657,664	S1100P	probably damaging	Het
Spag16	T	G	1: 69,853,352	N97K	probably benign	Het
Tmem192	T	C	8: 64,959,511	V114A	possibly damaging	Het
Urb1	G	T	16: 90,756,171	P1901T	probably benign	Het
Vwa5b2	A	G	16: 20,600,709	T601A	probably damaging	Het
Wdtc1	G	T	4: 133,308,851	T126K	possibly damaging	Het
Xirp2	T	C	2: 67,525,670	Y3592H	possibly damaging	Het
Xylt2	A	T	11: 94,670,016	V232E	probably damaging	Het

Other mutations in Pla2g4d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pla2g4d	APN	2	120281726	missense	probably damaging	1.00
IGL01405:Pla2g4d	APN	2	120266823	missense	probably benign	0.01
IGL01642:Pla2g4d	APN	2	120280636	missense	probably damaging	1.00
IGL01657:Pla2g4d	APN	2	120275287	missense	possibly damaging	0.91
BB001:Pla2g4d	UTSW	2	120289164	start gained	probably benign
R0962:Pla2g4d	UTSW	2	120280617	critical splice donor site	probably null
R1564:Pla2g4d	UTSW	2	120268903	missense	possibly damaging	0.76
R1576:Pla2g4d	UTSW	2	120284167	missense	probably damaging	1.00
R1667:Pla2g4d	UTSW	2	120270150	splice site	probably benign
R1680:Pla2g4d	UTSW	2	120277750	critical splice donor site	probably null
R1712:Pla2g4d	UTSW	2	120277490	missense	possibly damaging	0.51
R2253:Pla2g4d	UTSW	2	120271141	missense	probably damaging	0.99
R2919:Pla2g4d	UTSW	2	120281627	splice site	probably benign
R3122:Pla2g4d	UTSW	2	120278903	missense	probably benign	0.03
R4420:Pla2g4d	UTSW	2	120284163	missense	probably benign
R4737:Pla2g4d	UTSW	2	120266790	missense	probably benign	0.00
R4829:Pla2g4d	UTSW	2	120266743	missense	probably damaging	1.00
R5530:Pla2g4d	UTSW	2	120269555	missense	probably benign	0.06
R5677:Pla2g4d	UTSW	2	120278948	missense	possibly damaging	0.87
R6087:Pla2g4d	UTSW	2	120270006	missense	probably damaging	1.00
R6088:Pla2g4d	UTSW	2	120270006	missense	probably damaging	1.00
R6150:Pla2g4d	UTSW	2	120269564	missense	probably damaging	1.00
R6930:Pla2g4d	UTSW	2	120270633	missense	probably damaging	1.00
R7240:Pla2g4d	UTSW	2	120270349	missense	probably damaging	1.00
R7284:Pla2g4d	UTSW	2	120284136	missense	probably damaging	1.00
R7339:Pla2g4d	UTSW	2	120278978	missense	probably benign
R7552:Pla2g4d	UTSW	2	120284139	missense	possibly damaging	0.56
R7607:Pla2g4d	UTSW	2	120288976	missense	probably benign
R7692:Pla2g4d	UTSW	2	120279295	missense	possibly damaging	0.84
R7860:Pla2g4d	UTSW	2	120266730	missense	probably benign	0.13
R7924:Pla2g4d	UTSW	2	120289164	start gained	probably benign
R7972:Pla2g4d	UTSW	2	120278932	missense	probably benign	0.04
R8373:Pla2g4d	UTSW	2	120277499	missense	probably null	1.00
R8737:Pla2g4d	UTSW	2	120269985	missense	probably damaging	1.00
R8752:Pla2g4d	UTSW	2	120268767	critical splice donor site	probably null
R8987:Pla2g4d	UTSW	2	120269961	missense	probably damaging	1.00
R9221:Pla2g4d	UTSW	2	120269972	missense	possibly damaging	0.76
R9251:Pla2g4d	UTSW	2	120268897	missense	possibly damaging	0.87
R9740:Pla2g4d	UTSW	2	120277471	missense	probably damaging	1.00
X0026:Pla2g4d	UTSW	2	120277471	missense	probably damaging	0.99
X0028:Pla2g4d	UTSW	2	120281726	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCGACCAGTCCCTTTCCTG -3'
(R):5'- GGCGAGGGTAGATTAGATCCAA -3'

Sequencing Primer
(F):5'- GTTCAATGAGAATCAGCTTTTGTCCC -3'
(R):5'- GACAGTGGCAGTGTACTCACATTC -3'

Posted On

2016-06-06