Incidental Mutation 'R5032:Pik3c2g'
ID391752
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 042623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5032 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139896202 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 778 (T778S)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect probably benign
Transcript: ENSMUST00000087657
AA Change: T410S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: T410S

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111868
AA Change: T778S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: T778S

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189374
SMART Domains Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206646
AA Change: T410S
Predicted Effect probably benign
Transcript: ENSMUST00000218528
AA Change: T660S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5346 T C 8: 43,626,471 N239D probably damaging Het
Gm5592 A G 7: 41,289,735 R814G probably damaging Het
Gmps A G 3: 63,990,325 K233E probably benign Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hc T C 2: 35,013,532 I1037V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Kifc3 A G 8: 95,102,726 S508P probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mta1 T A 12: 113,133,525 probably null Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Myo3a T C 2: 22,282,602 L175P probably damaging Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAACATAAGGCCCAATG -3'
(R):5'- GGAACTGTTCCCTCTCATGG -3'

Sequencing Primer
(F):5'- CCCAATGATAAACAAAGCCATGGGG -3'
(R):5'- GCACAGACAGGTTTAGACT -3'
Posted On2016-06-06