Incidental Mutation 'R5032:Gm5592'
ID391755
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Namepredicted gene 5592
Synonyms
MMRRC Submission 042623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5032 (G1)
Quality Score174
Status Not validated
Chromosome7
Chromosomal Location41153841-41290183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41289735 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 814 (R814G)
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]
Predicted Effect probably damaging
Transcript: ENSMUST00000097044
AA Change: R814G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: R814G

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 6.1e-60 PFAM
low complexity region 607 612 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187120
Predicted Effect probably damaging
Transcript: ENSMUST00000206490
AA Change: R814G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5346 T C 8: 43,626,471 N239D probably damaging Het
Gmps A G 3: 63,990,325 K233E probably benign Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hc T C 2: 35,013,532 I1037V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Kifc3 A G 8: 95,102,726 S508P probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mta1 T A 12: 113,133,525 probably null Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Myo3a T C 2: 22,282,602 L175P probably damaging Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3c2g A T 6: 139,896,202 T778S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3623:Gm5592 UTSW 7 41157628 intron probably benign
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4127:Gm5592 UTSW 7 41289067 missense probably benign 0.00
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4304:Gm5592 UTSW 7 41286262 missense probably benign 0.20
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4408:Gm5592 UTSW 7 41286448 missense probably benign 0.04
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6117:Gm5592 UTSW 7 41288464 missense probably benign 0.00
R6324:Gm5592 UTSW 7 41286535 missense probably damaging 0.98
R6449:Gm5592 UTSW 7 41288586 missense probably benign 0.09
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7774:Gm5592 UTSW 7 41289859 missense probably damaging 1.00
R7788:Gm5592 UTSW 7 41286694 missense probably benign 0.01
R7890:Gm5592 UTSW 7 41286759 missense probably damaging 1.00
R8070:Gm5592 UTSW 7 41286463 missense possibly damaging 0.76
R8417:Gm5592 UTSW 7 41288551 missense probably benign 0.38
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Z1176:Gm5592 UTSW 7 41286317 missense probably damaging 1.00
Z1176:Gm5592 UTSW 7 41286319 missense possibly damaging 0.94
Z1176:Gm5592 UTSW 7 41288681 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGTGCTGTGCCCCATTTG -3'
(R):5'- TGTTGGAAAGCACTTTGTTGCAATG -3'

Sequencing Primer
(F):5'- ATTTGGTCACCTCGAGGCCTG -3'
(R):5'- GCAATGATCTGGCAAGCTGTTAC -3'
Posted On2016-06-06