Incidental Mutation 'R5032:Gm5346'
ID391759
Institutional Source Beutler Lab
Gene Symbol Gm5346
Ensembl Gene ENSMUSG00000050190
Gene Namepredicted gene 5346
Synonyms
MMRRC Submission 042623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5032 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location43624951-43627276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43626471 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 239 (N239D)
Ref Sequence ENSEMBL: ENSMUSP00000058858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056023]
Predicted Effect probably damaging
Transcript: ENSMUST00000056023
AA Change: N239D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: N239D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 159 1.3e-18 PFAM
Pfam:Reprolysin_5 205 384 1.1e-15 PFAM
Pfam:Reprolysin_4 205 393 6.2e-9 PFAM
Pfam:Reprolysin 207 397 1.7e-46 PFAM
Pfam:Reprolysin_2 223 389 5.7e-14 PFAM
Pfam:Reprolysin_3 231 352 2.6e-13 PFAM
DISIN 416 491 2.48e-38 SMART
ACR 492 628 3.4e-65 SMART
EGF 634 664 2.69e1 SMART
transmembrane domain 685 707 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5592 A G 7: 41,289,735 R814G probably damaging Het
Gmps A G 3: 63,990,325 K233E probably benign Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hc T C 2: 35,013,532 I1037V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Kifc3 A G 8: 95,102,726 S508P probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mta1 T A 12: 113,133,525 probably null Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Myo3a T C 2: 22,282,602 L175P probably damaging Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3c2g A T 6: 139,896,202 T778S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in Gm5346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gm5346 APN 8 43625381 missense probably benign 0.12
IGL00391:Gm5346 APN 8 43625629 missense probably damaging 1.00
IGL00422:Gm5346 APN 8 43626351 missense probably damaging 1.00
IGL00664:Gm5346 APN 8 43625969 missense probably benign
IGL01095:Gm5346 APN 8 43626096 missense probably benign 0.22
IGL01113:Gm5346 APN 8 43626152 missense probably damaging 1.00
IGL01444:Gm5346 APN 8 43626433 missense probably benign 0.06
IGL01782:Gm5346 APN 8 43626735 missense probably benign 0.01
IGL01921:Gm5346 APN 8 43625511 missense probably damaging 0.96
IGL01964:Gm5346 APN 8 43626761 missense probably benign 0.00
IGL02139:Gm5346 APN 8 43625578 missense probably benign 0.01
IGL02555:Gm5346 APN 8 43625268 missense probably damaging 1.00
IGL02951:Gm5346 APN 8 43627088 missense possibly damaging 0.62
R0056:Gm5346 UTSW 8 43625503 nonsense probably null
R0218:Gm5346 UTSW 8 43626440 missense probably benign 0.00
R0530:Gm5346 UTSW 8 43626531 missense probably benign 0.00
R0925:Gm5346 UTSW 8 43626303 missense probably benign 0.11
R0927:Gm5346 UTSW 8 43625123 missense probably benign 0.00
R0975:Gm5346 UTSW 8 43625118 missense probably benign
R1300:Gm5346 UTSW 8 43626844 nonsense probably null
R1728:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1729:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1801:Gm5346 UTSW 8 43625917 nonsense probably null
R1869:Gm5346 UTSW 8 43625095 nonsense probably null
R1870:Gm5346 UTSW 8 43625095 nonsense probably null
R1871:Gm5346 UTSW 8 43625095 nonsense probably null
R1992:Gm5346 UTSW 8 43627139 missense probably benign 0.44
R2008:Gm5346 UTSW 8 43627037 missense probably benign 0.00
R2013:Gm5346 UTSW 8 43626405 missense possibly damaging 0.81
R2022:Gm5346 UTSW 8 43625917 nonsense probably null
R2175:Gm5346 UTSW 8 43625438 missense probably benign
R2875:Gm5346 UTSW 8 43627140 nonsense probably null
R3406:Gm5346 UTSW 8 43626052 nonsense probably null
R3845:Gm5346 UTSW 8 43626632 missense probably benign 0.00
R4033:Gm5346 UTSW 8 43626673 missense probably benign 0.28
R4072:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4074:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4075:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4076:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4153:Gm5346 UTSW 8 43626527 missense probably benign 0.04
R4330:Gm5346 UTSW 8 43626250 missense probably benign
R4612:Gm5346 UTSW 8 43626550 missense probably benign 0.09
R4662:Gm5346 UTSW 8 43627079 missense probably benign 0.26
R5077:Gm5346 UTSW 8 43627163 missense possibly damaging 0.79
R5504:Gm5346 UTSW 8 43625282 missense probably damaging 1.00
R5697:Gm5346 UTSW 8 43626579 missense probably damaging 1.00
R6232:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6233:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6234:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6235:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6241:Gm5346 UTSW 8 43626096 missense probably benign 0.22
R6392:Gm5346 UTSW 8 43626001 missense probably benign 0.09
R6439:Gm5346 UTSW 8 43625951 missense probably damaging 1.00
R6454:Gm5346 UTSW 8 43626808 missense probably damaging 0.96
R6455:Gm5346 UTSW 8 43626152 missense probably damaging 1.00
R6767:Gm5346 UTSW 8 43626914 missense probably damaging 1.00
R6774:Gm5346 UTSW 8 43625183 missense probably benign 0.00
R6877:Gm5346 UTSW 8 43625237 missense probably benign 0.02
R6911:Gm5346 UTSW 8 43625109 missense probably benign 0.02
R7211:Gm5346 UTSW 8 43625877 missense probably damaging 1.00
R7597:Gm5346 UTSW 8 43625244 missense probably damaging 1.00
R7602:Gm5346 UTSW 8 43626666 missense probably damaging 0.99
R7797:Gm5346 UTSW 8 43626374 missense probably benign 0.04
R8154:Gm5346 UTSW 8 43625387 missense probably damaging 0.97
R8215:Gm5346 UTSW 8 43626501 missense probably benign 0.05
RF001:Gm5346 UTSW 8 43626905 missense possibly damaging 0.79
Z1177:Gm5346 UTSW 8 43626546 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATATCATGTCTAACACGATTGCC -3'
(R):5'- ACAGTGGGGAGTCAGAACCATC -3'

Sequencing Primer
(F):5'- CAATCGCATTTTTCTTCCAACTACAG -3'
(R):5'- GGAGTCAGAACCATCTCCCATGAG -3'
Posted On2016-06-06