Incidental Mutation 'R5032:Kifc3'
ID 391761
Institutional Source Beutler Lab
Gene Symbol Kifc3
Ensembl Gene ENSMUSG00000031788
Gene Name kinesin family member C3
Synonyms
MMRRC Submission 042623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5032 (G1)
Quality Score 203
Status Validated
Chromosome 8
Chromosomal Location 95099828-95202812 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95102726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 508 (S508P)
Ref Sequence ENSEMBL: ENSMUSP00000148425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]
AlphaFold O35231
Predicted Effect probably benign
Transcript: ENSMUST00000034239
SMART Domains Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787

DomainStartEndE-ValueType
WD40 9 49 2.61e-3 SMART
WD40 52 91 2.45e-8 SMART
WD40 94 133 3.58e-10 SMART
WD40 136 175 7.49e-13 SMART
WD40 178 217 5.14e-11 SMART
WD40 220 258 1.14e-3 SMART
low complexity region 354 373 N/A INTRINSIC
low complexity region 396 412 N/A INTRINSIC
Pfam:Katanin_con80 496 654 8.2e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034240
AA Change: S645P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788
AA Change: S645P

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169353
AA Change: S530P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788
AA Change: S530P

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169748
AA Change: S599P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788
AA Change: S599P

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212895
Predicted Effect probably benign
Transcript: ENSMUST00000212968
Predicted Effect probably damaging
Transcript: ENSMUST00000213004
AA Change: S508P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9743 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5346 T C 8: 43,626,471 N239D probably damaging Het
Gm5592 A G 7: 41,289,735 R814G probably damaging Het
Gmps A G 3: 63,990,325 K233E probably benign Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hc T C 2: 35,013,532 I1037V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mta1 T A 12: 113,133,525 probably null Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Myo3a T C 2: 22,282,602 L175P probably damaging Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3c2g A T 6: 139,896,202 T778S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in Kifc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Kifc3 APN 8 95138016 missense probably damaging 1.00
IGL01904:Kifc3 APN 8 95137957 missense possibly damaging 0.81
IGL02019:Kifc3 APN 8 95107540 splice site probably benign
IGL02090:Kifc3 APN 8 95102480 missense probably damaging 1.00
IGL02355:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02362:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02620:Kifc3 APN 8 95109954 missense probably damaging 0.98
IGL02720:Kifc3 APN 8 95108365 missense probably benign 0.00
IGL03030:Kifc3 APN 8 95102412 missense probably damaging 1.00
IGL03327:Kifc3 APN 8 95108432 missense probably damaging 1.00
IGL03390:Kifc3 APN 8 95108613 missense probably damaging 1.00
R0233:Kifc3 UTSW 8 95101472 splice site probably null
R0281:Kifc3 UTSW 8 95103460 missense probably damaging 1.00
R0302:Kifc3 UTSW 8 95103470 missense possibly damaging 0.50
R0619:Kifc3 UTSW 8 95102665 missense probably benign 0.13
R0731:Kifc3 UTSW 8 95105733 missense probably damaging 1.00
R1017:Kifc3 UTSW 8 95105785 missense probably damaging 0.99
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1257:Kifc3 UTSW 8 95105772 missense probably damaging 0.98
R1472:Kifc3 UTSW 8 95137913 critical splice donor site probably null
R1480:Kifc3 UTSW 8 95109887 missense probably damaging 1.00
R1553:Kifc3 UTSW 8 95106542 missense possibly damaging 0.67
R2071:Kifc3 UTSW 8 95108353 critical splice donor site probably null
R2115:Kifc3 UTSW 8 95108713 missense probably damaging 1.00
R3703:Kifc3 UTSW 8 95104028 splice site probably benign
R3704:Kifc3 UTSW 8 95104028 splice site probably benign
R3705:Kifc3 UTSW 8 95104028 splice site probably benign
R4223:Kifc3 UTSW 8 95109982 missense probably damaging 0.96
R4463:Kifc3 UTSW 8 95102116 missense probably damaging 1.00
R4508:Kifc3 UTSW 8 95107420 splice site probably null
R4980:Kifc3 UTSW 8 95126549 missense probably benign
R5068:Kifc3 UTSW 8 95110216 missense possibly damaging 0.54
R5421:Kifc3 UTSW 8 95109845 missense probably damaging 0.99
R5556:Kifc3 UTSW 8 95108459 nonsense probably null
R6845:Kifc3 UTSW 8 95108679 missense probably benign 0.28
R7136:Kifc3 UTSW 8 95103449 missense probably benign 0.10
R7196:Kifc3 UTSW 8 95106611 missense probably benign 0.02
R7404:Kifc3 UTSW 8 95103464 missense probably benign 0.02
R7441:Kifc3 UTSW 8 95137987 missense probably benign 0.00
R7784:Kifc3 UTSW 8 95110692 critical splice donor site probably null
R7861:Kifc3 UTSW 8 95107537 critical splice acceptor site probably null
R8440:Kifc3 UTSW 8 95109794 missense possibly damaging 0.89
R8754:Kifc3 UTSW 8 95102396 missense probably damaging 1.00
R8983:Kifc3 UTSW 8 95106476 missense probably damaging 1.00
R9035:Kifc3 UTSW 8 95126567 missense possibly damaging 0.52
R9149:Kifc3 UTSW 8 95126689 missense probably benign
R9464:Kifc3 UTSW 8 95103994 missense possibly damaging 0.61
X0023:Kifc3 UTSW 8 95109298 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCCACCAGGTTCAGCTTC -3'
(R):5'- CACCAACAGCTGCTCTGGT -3'

Sequencing Primer
(F):5'- AGGTTCAGCTTCCCTGCAG -3'
(R):5'- AAGATGTGATGCTGTCCACC -3'
Posted On 2016-06-06