Mutagenetix > Incidental Mutations

Incidental Mutation 'R5032:Kifc3'

391761

Institutional Source

Beutler Lab

Gene Symbol

Kifc3

Ensembl Gene

ENSMUSG00000031788

Gene Name

kinesin family member C3

Synonyms

MMRRC Submission

042623-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5032 (G1)

Quality Score

203

Status

Validated

Chromosome

Chromosomal Location

95099828-95202812 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 95102726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 508 (S508P)

Ref Sequence

ENSEMBL: ENSMUSP00000148425 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]

AlphaFold

O35231

Predicted Effect

probably benign
Transcript: ENSMUST00000034239

SMART Domains

Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787

Domain	Start	End	E-Value	Type
WD40	9	49	2.61e-3	SMART
WD40	52	91	2.45e-8	SMART
WD40	94	133	3.58e-10	SMART
WD40	136	175	7.49e-13	SMART
WD40	178	217	5.14e-11	SMART
WD40	220	258	1.14e-3	SMART
low complexity region	354	373	N/A	INTRINSIC
low complexity region	396	412	N/A	INTRINSIC
Pfam:Katanin_con80	496	654	8.2e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000034240
AA Change: S645P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788
AA Change: S645P

Domain	Start	End	E-Value	Type
low complexity region	33	46	N/A	INTRINSIC
coiled coil region	100	360	N/A	INTRINSIC
coiled coil region	393	430	N/A	INTRINSIC
KISc	441	774	3.15e-158	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169353
AA Change: S530P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788
AA Change: S530P

Domain	Start	End	E-Value	Type
coiled coil region	33	223	N/A	INTRINSIC
coiled coil region	256	293	N/A	INTRINSIC
KISc	304	637	3.15e-158	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169748
AA Change: S599P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788
AA Change: S599P

Domain	Start	End	E-Value	Type
coiled coil region	34	324	N/A	INTRINSIC
coiled coil region	357	394	N/A	INTRINSIC
KISc	405	728	3.11e-148	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211854

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212656

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212895

Predicted Effect

probably benign
Transcript: ENSMUST00000212968

Predicted Effect

probably damaging
Transcript: ENSMUST00000213004
AA Change: S508P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9743

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.0%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Actl9	A	G	17: 33,434,088	N374S	probably benign	Het
Ahcyl2	T	A	6: 29,768,556		probably benign	Het
Arfgef2	T	C	2: 166,878,544	M1501T	probably benign	Het
Asb17	A	T	3: 153,844,538	D69V	probably damaging	Het
Atp13a5	T	C	16: 29,263,450	Y877C	probably damaging	Het
Atrip	T	C	9: 109,065,203	Q64R	probably benign	Het
Auts2	A	G	5: 131,476,891		probably benign	Het
Cacna2d1	G	T	5: 16,359,070	R893L	probably damaging	Het
Ccdc138	C	T	10: 58,573,636	R596C	probably damaging	Het
Cd163	A	G	6: 124,311,669	Y353C	probably damaging	Het
Cdon	T	C	9: 35,489,034	Y1015H	probably damaging	Het
Chsy3	T	C	18: 59,179,471	Y339H	probably damaging	Het
Cspp1	T	C	1: 10,066,519	W190R	probably benign	Het
Ddx1	A	T	12: 13,223,992	I570N	probably damaging	Het
Duox1	G	A	2: 122,337,317	R1027H	probably benign	Het
Dync1h1	C	T	12: 110,626,892	Q1198*	probably null	Het
Ecel1	G	A	1: 87,154,253	S246L	probably damaging	Het
Fam228b	T	G	12: 4,763,042	R109S	probably damaging	Het
Fut9	T	A	4: 25,799,245		probably benign	Het
Gm5346	T	C	8: 43,626,471	N239D	probably damaging	Het
Gm5592	A	G	7: 41,289,735	R814G	probably damaging	Het
Gmps	A	G	3: 63,990,325	K233E	probably benign	Het
Gramd1c	A	G	16: 43,990,663	Y438H	probably damaging	Het
Gsdmc	A	T	15: 63,802,033	D134E	possibly damaging	Het
Gxylt2	A	G	6: 100,783,181	I226V	probably benign	Het
Hc	T	C	2: 35,013,532	I1037V	probably benign	Het
Hspa4	T	G	11: 53,289,123	R69S	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Krt7	G	A	15: 101,412,547	R25H	probably benign	Het
Lhfp	T	A	3: 53,043,433	S43T	possibly damaging	Het
Lrrc7	T	A	3: 158,181,580	K394N	possibly damaging	Het
Lypd4	A	T	7: 24,866,815	L28Q	probably damaging	Het
Mdc1	A	G	17: 35,850,589	E798G	probably benign	Het
Mta1	T	A	12: 113,133,525		probably null	Het
Mtg2	A	T	2: 180,083,390	Q132L	possibly damaging	Het
Myh1	G	T	11: 67,206,048	E382*	probably null	Het
Myo3a	T	C	2: 22,282,602	L175P	probably damaging	Het
Nckap5	A	T	1: 125,977,049	F144L	possibly damaging	Het
Nfrkb	T	A	9: 31,389,055		probably null	Het
Nmt2	C	T	2: 3,284,392	P5L	probably benign	Het
Nsmf	T	C	2: 25,055,061		probably null	Het
Olfr635	A	T	7: 103,979,374	M61L	probably damaging	Het
Olfr76	T	A	19: 12,120,056	I219F	probably benign	Het
Oprl1	C	T	2: 181,719,002	R257C	probably damaging	Het
Pcdhgc3	T	A	18: 37,807,585	N346K	probably damaging	Het
Pcnt	G	A	10: 76,355,077	P2791S	probably benign	Het
Pdia3	A	G	2: 121,414,139	N11S	probably benign	Het
Pik3c2g	A	T	6: 139,896,202	T778S	probably benign	Het
Pik3ip1	T	A	11: 3,333,520	I75N	probably damaging	Het
Pla2g4d	A	T	2: 120,281,695	Y118*	probably null	Het
Ppargc1b	A	G	18: 61,307,265	S845P	probably damaging	Het
Prdm2	A	T	4: 143,179,367	L50*	probably null	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Pxdn	G	A	12: 30,003,141	V926I	probably benign	Het
Rab11fip2	A	T	19: 59,937,367	N139K	probably damaging	Het
Rcn2	T	A	9: 56,053,016	M189K	probably damaging	Het
Rev1	A	T	1: 38,074,489		probably benign	Het
Rhbg	C	A	3: 88,245,134	G368C	probably damaging	Het
Rnf214	A	G	9: 45,899,744		probably null	Het
Sf3a3	T	C	4: 124,725,166	S307P	probably benign	Het
Slc6a18	T	A	13: 73,666,323	Y494F	probably damaging	Het
Son	T	C	16: 91,657,664	S1100P	probably damaging	Het
Spag16	T	G	1: 69,853,352	N97K	probably benign	Het
Tmem192	T	C	8: 64,959,511	V114A	possibly damaging	Het
Urb1	G	T	16: 90,756,171	P1901T	probably benign	Het
Vwa5b2	A	G	16: 20,600,709	T601A	probably damaging	Het
Wdtc1	G	T	4: 133,308,851	T126K	possibly damaging	Het
Xirp2	T	C	2: 67,525,670	Y3592H	possibly damaging	Het
Xylt2	A	T	11: 94,670,016	V232E	probably damaging	Het

Other mutations in Kifc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00720:Kifc3	APN	8	95138016	missense	probably damaging	1.00
IGL01904:Kifc3	APN	8	95137957	missense	possibly damaging	0.81
IGL02019:Kifc3	APN	8	95107540	splice site	probably benign
IGL02090:Kifc3	APN	8	95102480	missense	probably damaging	1.00
IGL02355:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02362:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02620:Kifc3	APN	8	95109954	missense	probably damaging	0.98
IGL02720:Kifc3	APN	8	95108365	missense	probably benign	0.00
IGL03030:Kifc3	APN	8	95102412	missense	probably damaging	1.00
IGL03327:Kifc3	APN	8	95108432	missense	probably damaging	1.00
IGL03390:Kifc3	APN	8	95108613	missense	probably damaging	1.00
R0233:Kifc3	UTSW	8	95101472	splice site	probably null
R0281:Kifc3	UTSW	8	95103460	missense	probably damaging	1.00
R0302:Kifc3	UTSW	8	95103470	missense	possibly damaging	0.50
R0619:Kifc3	UTSW	8	95102665	missense	probably benign	0.13
R0731:Kifc3	UTSW	8	95105733	missense	probably damaging	1.00
R1017:Kifc3	UTSW	8	95105785	missense	probably damaging	0.99
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1257:Kifc3	UTSW	8	95105772	missense	probably damaging	0.98
R1472:Kifc3	UTSW	8	95137913	critical splice donor site	probably null
R1480:Kifc3	UTSW	8	95109887	missense	probably damaging	1.00
R1553:Kifc3	UTSW	8	95106542	missense	possibly damaging	0.67
R2071:Kifc3	UTSW	8	95108353	critical splice donor site	probably null
R2115:Kifc3	UTSW	8	95108713	missense	probably damaging	1.00
R3703:Kifc3	UTSW	8	95104028	splice site	probably benign
R3704:Kifc3	UTSW	8	95104028	splice site	probably benign
R3705:Kifc3	UTSW	8	95104028	splice site	probably benign
R4223:Kifc3	UTSW	8	95109982	missense	probably damaging	0.96
R4463:Kifc3	UTSW	8	95102116	missense	probably damaging	1.00
R4508:Kifc3	UTSW	8	95107420	splice site	probably null
R4980:Kifc3	UTSW	8	95126549	missense	probably benign
R5068:Kifc3	UTSW	8	95110216	missense	possibly damaging	0.54
R5421:Kifc3	UTSW	8	95109845	missense	probably damaging	0.99
R5556:Kifc3	UTSW	8	95108459	nonsense	probably null
R6845:Kifc3	UTSW	8	95108679	missense	probably benign	0.28
R7136:Kifc3	UTSW	8	95103449	missense	probably benign	0.10
R7196:Kifc3	UTSW	8	95106611	missense	probably benign	0.02
R7404:Kifc3	UTSW	8	95103464	missense	probably benign	0.02
R7441:Kifc3	UTSW	8	95137987	missense	probably benign	0.00
R7784:Kifc3	UTSW	8	95110692	critical splice donor site	probably null
R7861:Kifc3	UTSW	8	95107537	critical splice acceptor site	probably null
R8440:Kifc3	UTSW	8	95109794	missense	possibly damaging	0.89
R8754:Kifc3	UTSW	8	95102396	missense	probably damaging	1.00
R8983:Kifc3	UTSW	8	95106476	missense	probably damaging	1.00
R9035:Kifc3	UTSW	8	95126567	missense	possibly damaging	0.52
R9149:Kifc3	UTSW	8	95126689	missense	probably benign
R9464:Kifc3	UTSW	8	95103994	missense	possibly damaging	0.61
X0023:Kifc3	UTSW	8	95109298	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGTCCACCAGGTTCAGCTTC -3'
(R):5'- CACCAACAGCTGCTCTGGT -3'

Sequencing Primer
(F):5'- AGGTTCAGCTTCCCTGCAG -3'
(R):5'- AAGATGTGATGCTGTCCACC -3'

Posted On

2016-06-06