Incidental Mutation 'IGL03048:Vmn2r13'
ID391809
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Namevomeronasal 2, receptor 13
SynonymsGm4867
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #IGL03048 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109156068-109192107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109156285 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 760 (A760V)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
Predicted Effect probably damaging
Transcript: ENSMUST00000053253
AA Change: A760V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: A760V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,978,699 probably null Het
Anapc4 C T 5: 52,839,733 T116I probably benign Het
Arhgap45 C T 10: 80,017,017 R14C probably damaging Het
BC055324 G A 1: 163,964,525 A608V probably benign Het
Bysl T C 17: 47,602,635 probably null Het
Ccdc166 T A 15: 75,982,201 N10I possibly damaging Het
Chd1l T C 3: 97,597,763 S163G probably benign Het
Col6a3 A G 1: 90,810,248 V576A possibly damaging Het
Cpped1 T C 16: 11,828,475 T162A probably benign Het
Dcbld1 A T 10: 52,304,626 I200F probably damaging Het
Dock6 T C 9: 21,809,570 E1713G probably damaging Het
Evx1 T C 6: 52,315,754 L130P probably benign Het
Fam168a A G 7: 100,835,338 T228A probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxp4 A T 17: 47,880,840 M124K unknown Het
Gabrr3 A G 16: 59,430,130 H164R probably benign Het
Gm3839 T A 14: 11,281,873 I21F probably benign Het
Gm8994 A T 6: 136,329,200 T220S probably damaging Het
Greb1 C T 12: 16,733,331 C134Y probably damaging Het
Hddc2 G A 10: 31,316,336 V79I possibly damaging Het
Lbr T C 1: 181,838,544 probably benign Het
Mamdc4 C T 2: 25,569,072 R229K possibly damaging Het
Mtor T C 4: 148,546,390 probably benign Het
Ncoa1 T C 12: 4,267,922 R1137G probably damaging Het
Nlrp4d T C 7: 10,358,954 noncoding transcript Het
Oasl1 T A 5: 114,937,341 S487T possibly damaging Het
Olfr385 G C 11: 73,589,005 H244Q possibly damaging Het
Olfr736 G T 14: 50,392,788 V11L possibly damaging Het
Olfr952 A G 9: 39,426,769 F101L probably benign Het
Oprm1 T C 10: 6,829,064 I91T probably damaging Het
Pdzk1ip1 T A 4: 115,092,984 D147E probably benign Het
Per1 A G 11: 69,104,726 K711E probably damaging Het
Rab3gap1 A G 1: 127,937,477 N734S probably damaging Het
Rapgefl1 T C 11: 98,837,164 L4P possibly damaging Het
Sgk2 A G 2: 162,995,760 Y101C probably damaging Het
Tmem129 A G 5: 33,655,467 V179A possibly damaging Het
Ttn T C 2: 76,888,915 probably benign Het
Ttyh2 T A 11: 114,696,695 M174K probably benign Het
Vmn2r82 A T 10: 79,396,626 I820F probably damaging Het
Zswim4 T C 8: 84,211,975 M1093V possibly damaging Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109156098 missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109156702 missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109174219 missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109174115 missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109192017 missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109156282 missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109171779 missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109158089 missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109156532 missense probably damaging 0.98
R0123:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109156466 missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109156529 missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109173813 missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109156847 missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109174202 missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109174135 missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109158174 missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109191986 missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109192077 missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109171778 missense probably benign 0.05
R2680:Vmn2r13 UTSW 5 109174312 missense possibly damaging 0.66
R2888:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109171761 missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109156855 missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109156700 missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109156456 missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109175199 missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109156465 missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109174072 missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R5263:Vmn2r13 UTSW 5 109173975 missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109191939 missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109173714 missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109191994 missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109173980 missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109174100 missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109174301 missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109174116 missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109175219 missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109156674 nonsense probably null
R6486:Vmn2r13 UTSW 5 109156559 missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109156940 splice site probably null
R6700:Vmn2r13 UTSW 5 109175072 missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109158149 missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109156887 nonsense probably null
R7276:Vmn2r13 UTSW 5 109173779 missense probably damaging 1.00
R7363:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7443:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109171691 synonymous probably null
R7607:Vmn2r13 UTSW 5 109173640 missense probably damaging 0.98
R7719:Vmn2r13 UTSW 5 109171752 missense probably benign 0.00
X0066:Vmn2r13 UTSW 5 109156219 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTGGGAGAAAGATGCACCC -3'
(R):5'- GCACCTAACTTGGCCATTCC -3'

Sequencing Primer
(F):5'- TGCACCCTAGCAAGCCTG -3'
(R):5'- CCCATTTGTACCCTAATCCAACTAG -3'
Posted On2016-06-07