Incidental Mutation 'IGL03048:Greb1'
ID 391829
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Name gene regulated by estrogen in breast cancer protein
Synonyms 5730583K22Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03048 (G1)
Quality Score 145
Status Validated
Chromosome 12
Chromosomal Location 16720616-16850887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 16783332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 134 (C134Y)
Ref Sequence ENSEMBL: ENSMUSP00000124275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000161998] [ENSMUST00000162112]
AlphaFold Q3UHK3
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: C134Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: C134Y

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159120
AA Change: C134Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: C134Y

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect probably damaging
Transcript: ENSMUST00000161998
AA Change: C134Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124275
Gene: ENSMUSG00000036523
AA Change: C134Y

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: C134Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: C134Y

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Meta Mutation Damage Score 0.6254 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,868,711 (GRCm39) probably null Het
Anapc4 C T 5: 52,997,075 (GRCm39) T116I probably benign Het
Arhgap45 C T 10: 79,852,851 (GRCm39) R14C probably damaging Het
Bysl T C 17: 47,913,560 (GRCm39) probably null Het
Ccdc166 T A 15: 75,854,050 (GRCm39) N10I possibly damaging Het
Chd1l T C 3: 97,505,079 (GRCm39) S163G probably benign Het
Col6a3 A G 1: 90,737,970 (GRCm39) V576A possibly damaging Het
Cpped1 T C 16: 11,646,339 (GRCm39) T162A probably benign Het
Dcbld1 A T 10: 52,180,722 (GRCm39) I200F probably damaging Het
Dock6 T C 9: 21,720,866 (GRCm39) E1713G probably damaging Het
Eif4a3l1 A T 6: 136,306,198 (GRCm39) T220S probably damaging Het
Evx1 T C 6: 52,292,739 (GRCm39) L130P probably benign Het
Fam168a A G 7: 100,484,545 (GRCm39) T228A probably damaging Het
Fcna G C 2: 25,520,693 (GRCm39) probably benign Het
Firrm G A 1: 163,792,094 (GRCm39) A608V probably benign Het
Foxp4 A T 17: 48,191,765 (GRCm39) M124K unknown Het
Gabrr3 A G 16: 59,250,493 (GRCm39) H164R probably benign Het
Gapdhrt T A 14: 11,281,873 (GRCm38) I21F probably benign Het
Hddc2 G A 10: 31,192,332 (GRCm39) V79I possibly damaging Het
Lbr T C 1: 181,666,109 (GRCm39) probably benign Het
Mamdc4 C T 2: 25,459,084 (GRCm39) R229K possibly damaging Het
Mtor T C 4: 148,630,847 (GRCm39) probably benign Het
Ncoa1 T C 12: 4,317,922 (GRCm39) R1137G probably damaging Het
Nlrp4d T C 7: 10,092,881 (GRCm39) noncoding transcript Het
Oasl1 T A 5: 115,075,400 (GRCm39) S487T possibly damaging Het
Oprm1 T C 10: 6,779,064 (GRCm39) I91T probably damaging Het
Or11j4 G T 14: 50,630,245 (GRCm39) V11L possibly damaging Het
Or1e26 G C 11: 73,479,831 (GRCm39) H244Q possibly damaging Het
Or8g33 A G 9: 39,338,065 (GRCm39) F101L probably benign Het
Pdzk1ip1 T A 4: 114,950,181 (GRCm39) D147E probably benign Het
Per1 A G 11: 68,995,552 (GRCm39) K711E probably damaging Het
Rab3gap1 A G 1: 127,865,214 (GRCm39) N734S probably damaging Het
Rapgefl1 T C 11: 98,727,990 (GRCm39) L4P possibly damaging Het
Sgk2 A G 2: 162,837,680 (GRCm39) Y101C probably damaging Het
Tmem129 A G 5: 33,812,811 (GRCm39) V179A possibly damaging Het
Ttn T C 2: 76,719,259 (GRCm39) probably benign Het
Ttyh2 T A 11: 114,587,521 (GRCm39) M174K probably benign Het
Vmn2r13 G A 5: 109,304,151 (GRCm39) A760V probably damaging Het
Vmn2r82 A T 10: 79,232,460 (GRCm39) I820F probably damaging Het
Zswim4 T C 8: 84,938,604 (GRCm39) M1093V possibly damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16,761,962 (GRCm39) missense probably damaging 1.00
IGL01316:Greb1 APN 12 16,748,587 (GRCm39) missense probably benign 0.04
IGL01464:Greb1 APN 12 16,764,827 (GRCm39) missense probably damaging 0.99
IGL01474:Greb1 APN 12 16,734,502 (GRCm39) missense probably benign
IGL01522:Greb1 APN 12 16,751,202 (GRCm39) missense probably damaging 1.00
IGL01824:Greb1 APN 12 16,761,717 (GRCm39) nonsense probably null
IGL01837:Greb1 APN 12 16,734,452 (GRCm39) missense probably benign 0.19
IGL01991:Greb1 APN 12 16,749,682 (GRCm39) missense probably damaging 1.00
IGL01996:Greb1 APN 12 16,740,846 (GRCm39) missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16,756,233 (GRCm39) missense probably damaging 1.00
IGL02267:Greb1 APN 12 16,767,209 (GRCm39) missense probably benign 0.00
IGL02512:Greb1 APN 12 16,742,713 (GRCm39) missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16,756,296 (GRCm39) splice site probably benign
IGL02613:Greb1 APN 12 16,789,889 (GRCm39) critical splice donor site probably null
IGL02648:Greb1 APN 12 16,758,683 (GRCm39) missense probably damaging 1.00
IGL02679:Greb1 APN 12 16,758,724 (GRCm39) missense probably damaging 1.00
begraben UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
Eared UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
Humpback UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
pied_billed UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
rednecked UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
G1patch:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
R0083:Greb1 UTSW 12 16,746,452 (GRCm39) missense probably benign
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0220:Greb1 UTSW 12 16,732,287 (GRCm39) missense probably damaging 1.00
R0245:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0540:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0547:Greb1 UTSW 12 16,773,412 (GRCm39) missense probably benign
R0563:Greb1 UTSW 12 16,730,268 (GRCm39) missense probably benign 0.23
R0607:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0610:Greb1 UTSW 12 16,746,443 (GRCm39) missense probably benign
R0652:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0659:Greb1 UTSW 12 16,730,213 (GRCm39) missense probably damaging 0.99
R0945:Greb1 UTSW 12 16,723,803 (GRCm39) missense probably benign 0.31
R1055:Greb1 UTSW 12 16,732,252 (GRCm39) missense probably damaging 0.98
R1445:Greb1 UTSW 12 16,757,852 (GRCm39) missense probably damaging 1.00
R1471:Greb1 UTSW 12 16,761,775 (GRCm39) missense probably damaging 0.97
R1503:Greb1 UTSW 12 16,774,820 (GRCm39) nonsense probably null
R1566:Greb1 UTSW 12 16,761,829 (GRCm39) missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
R1623:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R1751:Greb1 UTSW 12 16,773,439 (GRCm39) splice site probably benign
R1778:Greb1 UTSW 12 16,740,895 (GRCm39) missense probably benign
R1842:Greb1 UTSW 12 16,746,244 (GRCm39) missense probably damaging 1.00
R2040:Greb1 UTSW 12 16,752,651 (GRCm39) missense probably damaging 1.00
R2153:Greb1 UTSW 12 16,749,533 (GRCm39) missense probably damaging 1.00
R2178:Greb1 UTSW 12 16,746,388 (GRCm39) missense probably damaging 1.00
R2194:Greb1 UTSW 12 16,740,909 (GRCm39) missense probably benign 0.08
R2248:Greb1 UTSW 12 16,730,379 (GRCm39) missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16,764,954 (GRCm39) missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16,774,923 (GRCm39) missense probably damaging 1.00
R2860:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2861:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2862:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2866:Greb1 UTSW 12 16,749,551 (GRCm39) missense probably damaging 1.00
R2890:Greb1 UTSW 12 16,754,479 (GRCm39) missense probably damaging 1.00
R3056:Greb1 UTSW 12 16,738,592 (GRCm39) missense probably damaging 0.96
R3863:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3864:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3956:Greb1 UTSW 12 16,732,300 (GRCm39) missense probably damaging 1.00
R4493:Greb1 UTSW 12 16,748,611 (GRCm39) missense probably benign 0.14
R4548:Greb1 UTSW 12 16,749,676 (GRCm39) missense probably damaging 1.00
R4683:Greb1 UTSW 12 16,761,774 (GRCm39) missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16,746,329 (GRCm39) missense probably damaging 1.00
R4770:Greb1 UTSW 12 16,731,357 (GRCm39) missense probably benign 0.03
R4838:Greb1 UTSW 12 16,734,361 (GRCm39) critical splice donor site probably null
R4925:Greb1 UTSW 12 16,731,472 (GRCm39) missense probably damaging 1.00
R4982:Greb1 UTSW 12 16,774,762 (GRCm39) missense probably damaging 0.98
R5009:Greb1 UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16,758,023 (GRCm39) intron probably benign
R5213:Greb1 UTSW 12 16,764,791 (GRCm39) nonsense probably null
R5310:Greb1 UTSW 12 16,766,760 (GRCm39) missense probably benign 0.09
R5353:Greb1 UTSW 12 16,738,567 (GRCm39) nonsense probably null
R5544:Greb1 UTSW 12 16,723,797 (GRCm39) missense probably damaging 1.00
R5605:Greb1 UTSW 12 16,758,727 (GRCm39) missense probably damaging 0.96
R5708:Greb1 UTSW 12 16,723,843 (GRCm39) missense probably benign 0.11
R5837:Greb1 UTSW 12 16,738,586 (GRCm39) missense probably damaging 1.00
R5890:Greb1 UTSW 12 16,783,422 (GRCm39) missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16,767,259 (GRCm39) missense probably damaging 1.00
R6049:Greb1 UTSW 12 16,731,395 (GRCm39) missense probably damaging 0.99
R6093:Greb1 UTSW 12 16,734,487 (GRCm39) missense probably benign
R6120:Greb1 UTSW 12 16,758,622 (GRCm39) missense probably damaging 0.99
R6175:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R6247:Greb1 UTSW 12 16,766,676 (GRCm39) missense probably damaging 1.00
R6274:Greb1 UTSW 12 16,785,152 (GRCm39) missense probably damaging 0.97
R6376:Greb1 UTSW 12 16,749,580 (GRCm39) missense probably damaging 0.97
R6523:Greb1 UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16,760,384 (GRCm39) missense probably benign 0.00
R6602:Greb1 UTSW 12 16,759,441 (GRCm39) missense probably benign 0.44
R6621:Greb1 UTSW 12 16,742,718 (GRCm39) missense probably damaging 1.00
R6645:Greb1 UTSW 12 16,748,580 (GRCm39) missense probably benign 0.07
R6725:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
R6750:Greb1 UTSW 12 16,738,584 (GRCm39) missense probably benign 0.05
R6863:Greb1 UTSW 12 16,734,421 (GRCm39) missense probably damaging 1.00
R6914:Greb1 UTSW 12 16,757,903 (GRCm39) missense probably damaging 0.97
R6996:Greb1 UTSW 12 16,773,355 (GRCm39) missense probably benign 0.00
R7083:Greb1 UTSW 12 16,773,315 (GRCm39) missense probably benign
R7147:Greb1 UTSW 12 16,783,428 (GRCm39) missense probably damaging 1.00
R7238:Greb1 UTSW 12 16,724,673 (GRCm39) missense probably damaging 0.99
R7290:Greb1 UTSW 12 16,761,739 (GRCm39) missense probably damaging 1.00
R7358:Greb1 UTSW 12 16,774,882 (GRCm39) missense probably damaging 1.00
R7395:Greb1 UTSW 12 16,759,431 (GRCm39) critical splice donor site probably null
R7526:Greb1 UTSW 12 16,766,766 (GRCm39) missense probably benign 0.00
R7530:Greb1 UTSW 12 16,767,207 (GRCm39) missense probably benign 0.02
R7536:Greb1 UTSW 12 16,732,186 (GRCm39) missense probably damaging 1.00
R7643:Greb1 UTSW 12 16,761,997 (GRCm39) missense probably damaging 0.99
R7732:Greb1 UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
R7740:Greb1 UTSW 12 16,790,122 (GRCm39) start gained probably benign
R7747:Greb1 UTSW 12 16,724,796 (GRCm39) missense probably benign 0.01
R7760:Greb1 UTSW 12 16,773,417 (GRCm39) missense probably benign
R7937:Greb1 UTSW 12 16,766,670 (GRCm39) missense probably damaging 0.99
R8043:Greb1 UTSW 12 16,761,790 (GRCm39) missense probably damaging 1.00
R8259:Greb1 UTSW 12 16,774,925 (GRCm39) nonsense probably null
R8553:Greb1 UTSW 12 16,773,328 (GRCm39) missense probably benign 0.00
R8559:Greb1 UTSW 12 16,746,436 (GRCm39) missense probably damaging 1.00
R8690:Greb1 UTSW 12 16,746,548 (GRCm39) missense probably benign 0.03
R8830:Greb1 UTSW 12 16,738,520 (GRCm39) missense probably benign 0.35
R8911:Greb1 UTSW 12 16,740,903 (GRCm39) missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16,774,885 (GRCm39) missense probably damaging 1.00
R8986:Greb1 UTSW 12 16,734,457 (GRCm39) missense probably damaging 0.99
R9013:Greb1 UTSW 12 16,789,970 (GRCm39) missense probably damaging 1.00
R9279:Greb1 UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
R9360:Greb1 UTSW 12 16,790,037 (GRCm39) missense probably damaging 1.00
R9563:Greb1 UTSW 12 16,774,824 (GRCm39) missense probably benign 0.06
R9616:Greb1 UTSW 12 16,790,038 (GRCm39) missense probably damaging 1.00
R9627:Greb1 UTSW 12 16,756,167 (GRCm39) missense probably damaging 1.00
R9731:Greb1 UTSW 12 16,738,598 (GRCm39) missense probably damaging 1.00
R9761:Greb1 UTSW 12 16,751,275 (GRCm39) missense probably benign 0.05
Z1176:Greb1 UTSW 12 16,746,757 (GRCm39) missense probably benign 0.00
Z1177:Greb1 UTSW 12 16,752,492 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGAAGGGAAGCAGACAGTC -3'
(R):5'- TTCGGGAGATCTCAGGACAG -3'

Sequencing Primer
(F):5'- CAGCTGTCATTCCTGAAGAACTG -3'
(R):5'- ACAGTGTGTGAGCCCTGTCTAAC -3'
Posted On 2016-06-07