Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03046:Megf10'

391885

Institutional Source

Beutler Lab

Gene Symbol

Megf10

Ensembl Gene

ENSMUSG00000024593

Gene Name

multiple EGF-like-domains 10

Synonyms

3000002B06Rik, LOC240312

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

IGL03046 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

57133090-57297467 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 57287983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 898 (A898S)

Ref Sequence

ENSEMBL: ENSMUSP00000116814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]

AlphaFold

Q6DIB5

Predicted Effect

probably benign
Transcript: ENSMUST00000075770
AA Change: A898S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: A898S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	108	136	9.41e-2	SMART
EGF_Lam	152	191	3.57e-2	SMART
EGF	190	222	5.79e-2	SMART
EGF	233	265	1.78e-2	SMART
EGF_Lam	281	320	7.58e-6	SMART
EGF	319	351	7.13e-2	SMART
EGF_Lam	368	409	9.05e-4	SMART
EGF	408	440	8.78e-2	SMART
EGF	451	483	2.85e-1	SMART
EGF	494	526	2.02e-1	SMART
EGF_Lam	542	581	1.04e-3	SMART
EGF	580	612	1.91e-2	SMART
EGF	623	657	2.16e1	SMART
EGF	668	700	2.48e-1	SMART
EGF	711	743	2.81e0	SMART
EGF_Lam	759	798	4.16e-3	SMART
EGF	797	829	1.73e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	1014	1026	N/A	INTRINSIC
low complexity region	1131	1146	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000139892
AA Change: A898S

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: A898S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	108	136	9.41e-2	SMART
EGF_Lam	152	191	3.57e-2	SMART
EGF	190	222	5.79e-2	SMART
EGF	233	265	1.78e-2	SMART
EGF_Lam	281	320	7.58e-6	SMART
EGF	319	351	7.13e-2	SMART
EGF_Lam	368	409	9.05e-4	SMART
EGF	408	440	8.78e-2	SMART
EGF	451	483	2.85e-1	SMART
EGF	494	526	2.02e-1	SMART
EGF_Lam	542	581	1.04e-3	SMART
EGF	580	612	1.91e-2	SMART
EGF	623	657	2.16e1	SMART
EGF	668	700	2.48e-1	SMART
EGF	711	743	2.81e0	SMART
EGF_Lam	759	798	4.16e-3	SMART
EGF	797	829	1.73e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	1014	1026	N/A	INTRINSIC

Meta Mutation Damage Score

0.1047

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,150	L279Q	possibly damaging	Het
A2m	T	A	6: 121,659,323	M717K	probably benign	Het
Acad12	C	A	5: 121,609,966	V130L	probably benign	Het
Cdca2	T	C	14: 67,700,022		probably benign	Het
Cfap100	T	A	6: 90,412,350		probably null	Het
Cfap43	T	A	19: 47,815,863	E298V	probably damaging	Het
Cic	C	T	7: 25,291,075	P1971S	probably damaging	Het
Cnga1	T	C	5: 72,604,338	D611G	probably benign	Het
Daglb	C	T	5: 143,501,193	P522L	probably damaging	Het
Dclre1b	A	T	3: 103,803,281	I438K	probably benign	Het
Ddx5	C	A	11: 106,785,045	R273M	probably damaging	Het
Eepd1	C	T	9: 25,482,685	L82F	probably damaging	Het
Emilin3	G	A	2: 160,908,729	Q320*	probably null	Het
Exoc6	T	C	19: 37,593,769		probably null	Het
Fcna	G	C	2: 25,630,681		probably benign	Het
Foxs1	T	C	2: 152,932,564	T190A	probably benign	Het
Gje1	A	G	10: 14,716,630	L136P	probably damaging	Het
Hdac11	A	G	6: 91,168,845	T176A	probably benign	Het
Hhip	C	A	8: 79,972,338	V700L	probably damaging	Het
Hps5	T	C	7: 46,777,039		probably benign	Het
Itgb1bp1	T	C	12: 21,279,435	S13G	unknown	Het
Kcna1	A	T	6: 126,642,185	L391M	possibly damaging	Het
Kif1a	C	T	1: 93,082,406	V6M	probably damaging	Het
Klhl6	T	C	16: 19,982,889	I39V	probably benign	Het
Lpcat4	C	A	2: 112,241,989		silent	Het
Ltn1	A	T	16: 87,405,621	S1047R	probably benign	Het
Mdn1	A	G	4: 32,694,495	T1073A	possibly damaging	Het
Mtmr6	T	C	14: 60,292,128		probably null	Het
Mtnr1b	T	C	9: 15,862,763	I333M	probably benign	Het
Muc5ac	G	T	7: 141,795,213	C463F	probably benign	Het
Mycbpap	G	T	11: 94,505,717	T99N	possibly damaging	Het
Myo7a	C	T	7: 98,079,327	C824Y	probably damaging	Het
N4bp2	A	G	5: 65,790,960	H311R	probably damaging	Het
Nepro	T	A	16: 44,732,146		probably benign	Het
Nop56	A	T	2: 130,275,569		probably benign	Het
Nup210	A	G	6: 91,018,996		probably benign	Het
Olfr1426	A	G	19: 12,088,027	V255A	probably damaging	Het
Olfr843	T	A	9: 19,249,145	I85F	probably damaging	Het
Pcna	C	T	2: 132,251,753	E109K	probably benign	Het
Pkhd1	T	G	1: 20,537,365	D1089A	possibly damaging	Het
Plb1	A	G	5: 32,328,412	R847G	probably damaging	Het
Pou6f2	A	G	13: 18,129,027		probably benign	Het
Prss43	C	G	9: 110,830,981	S371C	probably benign	Het
Ralgapa1	A	T	12: 55,695,157	V1322D	probably damaging	Het
Rrp8	A	G	7: 105,734,902	V131A	probably benign	Het
Rtp1	A	T	16: 23,429,294	K39M	probably benign	Het
Slc1a6	A	G	10: 78,800,174	I358V	probably benign	Het
Slc25a15	T	C	8: 22,395,710		probably benign	Het
Slc43a1	G	A	2: 84,854,553		probably benign	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Spock3	T	G	8: 63,348,984		probably null	Het
Tbc1d7	T	C	13: 43,154,686		probably null	Het
Tmem184c	C	T	8: 77,599,657	W260*	probably null	Het
Tmem8	A	T	17: 26,119,440		probably null	Het
Trnau1ap	A	G	4: 132,311,941	Y265H	probably damaging	Het
Usp25	T	C	16: 77,074,866	F363S	probably damaging	Het
Vcl	T	C	14: 21,022,017	F817L	possibly damaging	Het
Vmn1r13	T	A	6: 57,210,732	M292K	probably benign	Het
Xpc	G	T	6: 91,510,481	A89E	probably damaging	Het

Other mutations in Megf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Megf10	APN	18	57240628	missense	probably damaging	1.00
IGL00736:Megf10	APN	18	57292710	missense	probably benign	0.35
IGL01631:Megf10	APN	18	57259797	missense	possibly damaging	0.61
IGL02488:Megf10	APN	18	57292632	missense	probably damaging	1.00
IGL02747:Megf10	APN	18	57290493	missense	probably benign	0.43
IGL03298:Megf10	APN	18	57283838	nonsense	probably null
deep	UTSW	18	57262131	missense	probably damaging	1.00
megalodon	UTSW	18	57287976	nonsense	probably null
sharkie	UTSW	18	57191185	nonsense	probably null
PIT4696001:Megf10	UTSW	18	57277688	missense	probably damaging	1.00
R0020:Megf10	UTSW	18	57287893	missense	possibly damaging	0.81
R0020:Megf10	UTSW	18	57287893	missense	possibly damaging	0.81
R0115:Megf10	UTSW	18	57259802	missense	possibly damaging	0.67
R0455:Megf10	UTSW	18	57252982	missense	probably benign	0.34
R0602:Megf10	UTSW	18	57262100	missense	probably damaging	0.98
R0630:Megf10	UTSW	18	57287995	missense	probably benign	0.14
R0652:Megf10	UTSW	18	57277724	missense	probably benign	0.00
R0658:Megf10	UTSW	18	57252896	missense	probably benign	0.00
R0761:Megf10	UTSW	18	57287976	nonsense	probably null
R1013:Megf10	UTSW	18	57261219	missense	probably benign	0.00
R1130:Megf10	UTSW	18	57262006	missense	probably benign	0.06
R1451:Megf10	UTSW	18	57252859	missense	probably damaging	0.97
R1699:Megf10	UTSW	18	57277730	splice site	probably null
R1729:Megf10	UTSW	18	57240792	critical splice donor site	probably null
R1784:Megf10	UTSW	18	57240792	critical splice donor site	probably null
R1870:Megf10	UTSW	18	57191185	nonsense	probably null
R1961:Megf10	UTSW	18	57212354	missense	probably damaging	0.97
R2094:Megf10	UTSW	18	57281713	nonsense	probably null
R2213:Megf10	UTSW	18	57288009	nonsense	probably null
R2853:Megf10	UTSW	18	57293931	missense	probably damaging	1.00
R3772:Megf10	UTSW	18	57283862	missense	probably benign	0.39
R3774:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3775:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3776:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3858:Megf10	UTSW	18	57275835	splice site	probably benign
R3911:Megf10	UTSW	18	57289393	missense	probably damaging	0.99
R3966:Megf10	UTSW	18	57180574	missense	probably damaging	1.00
R4043:Megf10	UTSW	18	57259798	missense	probably damaging	0.98
R4131:Megf10	UTSW	18	57180535	missense	probably damaging	1.00
R4598:Megf10	UTSW	18	57189603	critical splice donor site	probably null
R4598:Megf10	UTSW	18	57287812	missense	probably damaging	1.00
R4726:Megf10	UTSW	18	57287792	missense	probably benign	0.32
R4765:Megf10	UTSW	18	57287794	missense	possibly damaging	0.56
R4874:Megf10	UTSW	18	57293858	missense	probably benign	0.00
R4928:Megf10	UTSW	18	57240673	missense	probably benign
R5412:Megf10	UTSW	18	57191147	missense	probably damaging	0.99
R5901:Megf10	UTSW	18	57277108	missense	probably benign	0.11
R6015:Megf10	UTSW	18	57253028	missense	probably benign	0.01
R6036:Megf10	UTSW	18	57242727	missense	probably damaging	1.00
R6036:Megf10	UTSW	18	57242727	missense	probably damaging	1.00
R6041:Megf10	UTSW	18	57180549	missense	probably benign
R6369:Megf10	UTSW	18	57261187	missense	probably benign	0.06
R6479:Megf10	UTSW	18	57246570	missense	possibly damaging	0.76
R6489:Megf10	UTSW	18	57291807	missense	probably benign	0.01
R7228:Megf10	UTSW	18	57189589	missense	probably damaging	1.00
R7296:Megf10	UTSW	18	57275753	missense	probably damaging	1.00
R7437:Megf10	UTSW	18	57262131	missense	probably damaging	1.00
R7461:Megf10	UTSW	18	57252853	missense	probably damaging	0.98
R7488:Megf10	UTSW	18	57191115	missense	probably damaging	0.99
R7492:Megf10	UTSW	18	57291794	missense	probably benign	0.00
R7542:Megf10	UTSW	18	57189570	missense	probably benign	0.07
R7636:Megf10	UTSW	18	57276989	missense	possibly damaging	0.85
R7646:Megf10	UTSW	18	57293999	unclassified	probably benign
R7650:Megf10	UTSW	18	57293999	unclassified	probably benign
R7713:Megf10	UTSW	18	57293999	unclassified	probably benign
R7714:Megf10	UTSW	18	57293999	unclassified	probably benign
R7716:Megf10	UTSW	18	57293999	unclassified	probably benign
R7796:Megf10	UTSW	18	57277659	missense	possibly damaging	0.85
R7915:Megf10	UTSW	18	57240735	missense	probably benign	0.05
R8221:Megf10	UTSW	18	57283821	missense	probably benign	0.00
R8527:Megf10	UTSW	18	57292718	missense	probably benign	0.00
R8559:Megf10	UTSW	18	57240627	missense	probably damaging	1.00
R9117:Megf10	UTSW	18	57259701	missense	probably damaging	1.00
R9337:Megf10	UTSW	18	57261180	nonsense	probably null
R9481:Megf10	UTSW	18	57262018	missense	probably benign	0.38
R9644:Megf10	UTSW	18	57242701	missense	probably benign
RF003:Megf10	UTSW	18	57294027	unclassified	probably benign
Z1176:Megf10	UTSW	18	57277694	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGAACCTGTATCTGGCCCAC -3'
(R):5'- ACCTCTTCAGAAGGTGAGGTC -3'

Sequencing Primer
(F):5'- TCATCGTGGGCAATCTGAAC -3'
(R):5'- GTGAGGTCACATCAAAACAAAAAC -3'

Posted On

2016-06-07