Incidental Mutation 'IGL02837:Trim45'
ID391898
Institutional Source Beutler Lab
Gene Symbol Trim45
Ensembl Gene ENSMUSG00000033233
Gene Nametripartite motif-containing 45
Synonyms4921530N01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02837 (G1)
Quality Score69
Status Validated
Chromosome3
Chromosomal Location100922202-100936920 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 100931627 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037409] [ENSMUST00000094048] [ENSMUST00000106980] [ENSMUST00000134993]
Predicted Effect probably benign
Transcript: ENSMUST00000037409
SMART Domains Protein: ENSMUSP00000043389
Gene: ENSMUSG00000033233

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094048
SMART Domains Protein: ENSMUSP00000091590
Gene: ENSMUSG00000033233

DomainStartEndE-ValueType
BBOX 81 127 1.03e-1 SMART
BBOX 137 178 4.34e-5 SMART
BBC 185 311 3.55e-9 SMART
IG_FLMN 349 451 7.63e-33 SMART
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106980
SMART Domains Protein: ENSMUSP00000102593
Gene: ENSMUSG00000033233

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134993
AA Change: T615I
SMART Domains Protein: ENSMUSP00000115669
Gene: ENSMUSG00000033233
AA Change: T615I

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif family. The encoded protein may function as a transcriptional repressor of the mitogen-activated protein kinase pathway. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,957,581 V786I probably benign Het
Adamts13 A G 2: 26,991,420 N803S probably benign Het
Ago4 C G 4: 126,497,300 G730R possibly damaging Het
Amn T A 12: 111,271,899 M55K possibly damaging Het
Apob A T 12: 8,005,102 Y1334F probably damaging Het
Arl14ep A C 2: 106,969,229 L89R probably damaging Het
Bcam T G 7: 19,764,186 E304A probably damaging Het
Car10 A T 11: 93,597,251 Y258F probably damaging Het
Cerk T A 15: 86,144,695 K82* probably null Het
Chac2 T C 11: 30,977,496 N141S probably damaging Het
Clpx T G 9: 65,324,259 L556R probably damaging Het
Csgalnact2 T C 6: 118,124,403 I55V probably benign Het
Cul1 T C 6: 47,523,205 V650A probably benign Het
Dnah5 A T 15: 28,269,400 E895D probably benign Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Dpys A G 15: 39,857,305 S20P probably damaging Het
Fat1 G A 8: 45,017,434 V1490I probably benign Het
Flg2 T G 3: 93,201,737 C357W probably damaging Het
Flt1 T A 5: 147,655,170 D494V probably benign Het
Fpr-rs4 T A 17: 18,022,251 D173E probably benign Het
Gm2666 G T 1: 85,485,103 noncoding transcript Het
Gm3867 C A 9: 36,257,800 noncoding transcript Het
Gm5436 A T 12: 84,258,600 noncoding transcript Het
Kit G A 5: 75,639,008 V467I probably benign Het
Krtap4-16 A G 11: 99,851,037 V179A unknown Het
Lrp8 C A 4: 107,861,281 H693Q probably benign Het
Lrrc49 A G 9: 60,610,322 S75P probably benign Het
Ltbp4 C A 7: 27,314,381 V1068L probably damaging Het
Magel2 C T 7: 62,378,260 P304L possibly damaging Het
Muc19 T A 15: 91,882,656 noncoding transcript Het
Npas3 T C 12: 53,947,197 V175A possibly damaging Het
Nr1h4 A T 10: 89,516,480 H8Q probably benign Het
Ntsr2 G A 12: 16,653,875 V126M probably damaging Het
Odf2 A T 2: 29,926,713 T725S probably damaging Het
Olfr12 T C 1: 92,620,682 Y259H possibly damaging Het
Olfr183 C T 16: 59,000,546 P287L probably damaging Het
Olfr603 C T 7: 103,383,615 C129Y probably damaging Het
Pgr T C 9: 8,946,638 probably benign Het
Pik3c2g T A 6: 139,626,564 C249* probably null Het
Plcd3 C T 11: 103,071,103 V726M possibly damaging Het
Prl8a1 A G 13: 27,575,634 L140P probably damaging Het
Prpf6 C A 2: 181,622,263 D239E probably damaging Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Rimbp2 G T 5: 128,797,745 Q268K probably damaging Het
Rps19-ps13 A T 18: 40,726,394 noncoding transcript Het
Sema4c C A 1: 36,552,884 G266V probably damaging Het
Sema4g T C 19: 44,996,711 F156S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Speer4f1 G T 5: 17,480,383 L225F unknown Het
Thrap3 T C 4: 126,165,364 probably benign Het
Tnfrsf8 T C 4: 145,268,998 E497G probably benign Het
Trim3 T C 7: 105,612,656 N631S probably damaging Het
Wdr43 A G 17: 71,642,736 D445G probably benign Het
Other mutations in Trim45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Trim45 APN 3 100931726 intron probably benign
IGL01472:Trim45 APN 3 100928065 missense probably benign 0.00
IGL01996:Trim45 APN 3 100928109 nonsense probably null 0.00
IGL02392:Trim45 APN 3 100925305 missense probably benign 0.04
IGL03229:Trim45 APN 3 100923069 missense probably damaging 1.00
R0021:Trim45 UTSW 3 100925420 missense probably damaging 1.00
R0243:Trim45 UTSW 3 100929844 missense probably benign 0.05
R0501:Trim45 UTSW 3 100923219 missense probably damaging 1.00
R1222:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1418:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1813:Trim45 UTSW 3 100922967 missense probably benign 0.16
R2148:Trim45 UTSW 3 100932044 nonsense probably null
R2383:Trim45 UTSW 3 100925227 missense probably damaging 0.97
R4368:Trim45 UTSW 3 100923186 missense probably damaging 1.00
R4769:Trim45 UTSW 3 100931734 intron probably benign
R4840:Trim45 UTSW 3 100925488 missense possibly damaging 0.95
R5030:Trim45 UTSW 3 100928072 missense probably damaging 1.00
R5272:Trim45 UTSW 3 100929919 missense probably damaging 1.00
R5298:Trim45 UTSW 3 100925471 missense probably damaging 1.00
R5498:Trim45 UTSW 3 100925141 missense possibly damaging 0.67
R5589:Trim45 UTSW 3 100929941 missense probably damaging 1.00
R6537:Trim45 UTSW 3 100925396 missense probably benign 0.39
R6850:Trim45 UTSW 3 100923225 nonsense probably null
R7009:Trim45 UTSW 3 100931879 intron probably benign
R7122:Trim45 UTSW 3 100932037 missense unknown
R7583:Trim45 UTSW 3 100925023 missense probably damaging 1.00
X0066:Trim45 UTSW 3 100931767 intron probably benign
Z1088:Trim45 UTSW 3 100925640 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCCCTTTGTATTATGCAGGTGG -3'
(R):5'- TTCCGTGGAGTAGATCAGCAG -3'

Sequencing Primer
(F):5'- GGATACCTTGGCTGTGGC -3'
(R):5'- TAGATCAGCAGCCTGCCTTGAG -3'
Posted On2016-06-08