Incidental Mutation 'IGL02837:Trim3'
ID 391916
Institutional Source Beutler Lab
Gene Symbol Trim3
Ensembl Gene ENSMUSG00000036989
Gene Name tripartite motif-containing 3
Synonyms BERP1, HAC1, Rnf22
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL02837 (G1)
Quality Score 81
Status Validated
Chromosome 7
Chromosomal Location 105253670-105282778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105261863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 631 (N631S)
Ref Sequence ENSEMBL: ENSMUSP00000114822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044]
AlphaFold Q9R1R2
Predicted Effect probably damaging
Transcript: ENSMUST00000057525
AA Change: N631S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: N631S

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106789
AA Change: N631S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: N631S

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
AA Change: N631S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: N631S

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147044
AA Change: N631S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: N631S

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156581
Meta Mutation Damage Score 0.2318 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 36,268,473 (GRCm39) V786I probably benign Het
Adamts13 A G 2: 26,881,432 (GRCm39) N803S probably benign Het
Ago4 C G 4: 126,391,093 (GRCm39) G730R possibly damaging Het
Amn T A 12: 111,238,333 (GRCm39) M55K possibly damaging Het
Apob A T 12: 8,055,102 (GRCm39) Y1334F probably damaging Het
Arl14ep A C 2: 106,799,574 (GRCm39) L89R probably damaging Het
Bcam T G 7: 19,498,111 (GRCm39) E304A probably damaging Het
Car10 A T 11: 93,488,077 (GRCm39) Y258F probably damaging Het
Cerk T A 15: 86,028,896 (GRCm39) K82* probably null Het
Chac2 T C 11: 30,927,496 (GRCm39) N141S probably damaging Het
Clpx T G 9: 65,231,541 (GRCm39) L556R probably damaging Het
Csgalnact2 T C 6: 118,101,364 (GRCm39) I55V probably benign Het
Cul1 T C 6: 47,500,139 (GRCm39) V650A probably benign Het
Dnah5 A T 15: 28,269,546 (GRCm39) E895D probably benign Het
Dnah9 T C 11: 65,765,022 (GRCm39) K3841E probably damaging Het
Dpys A G 15: 39,720,701 (GRCm39) S20P probably damaging Het
Fat1 G A 8: 45,470,471 (GRCm39) V1490I probably benign Het
Flg2 T G 3: 93,109,044 (GRCm39) C357W probably damaging Het
Flt1 T A 5: 147,591,980 (GRCm39) D494V probably benign Het
Fpr-rs4 T A 17: 18,242,513 (GRCm39) D173E probably benign Het
Gm2666 G T 1: 85,412,824 (GRCm39) noncoding transcript Het
Gm3867 C A 9: 36,169,096 (GRCm39) noncoding transcript Het
Gm5436 A T 12: 84,305,374 (GRCm39) noncoding transcript Het
Kit G A 5: 75,799,668 (GRCm39) V467I probably benign Het
Krtap4-16 A G 11: 99,741,863 (GRCm39) V179A unknown Het
Lrp8 C A 4: 107,718,478 (GRCm39) H693Q probably benign Het
Lrrc49 A G 9: 60,517,605 (GRCm39) S75P probably benign Het
Ltbp4 C A 7: 27,013,806 (GRCm39) V1068L probably damaging Het
Magel2 C T 7: 62,028,008 (GRCm39) P304L possibly damaging Het
Muc19 T A 15: 91,766,850 (GRCm39) noncoding transcript Het
Npas3 T C 12: 53,993,980 (GRCm39) V175A possibly damaging Het
Nr1h4 A T 10: 89,352,342 (GRCm39) H8Q probably benign Het
Ntsr2 G A 12: 16,703,876 (GRCm39) V126M probably damaging Het
Odf2 A T 2: 29,816,725 (GRCm39) T725S probably damaging Het
Or52e19b C T 7: 103,032,822 (GRCm39) C129Y probably damaging Het
Or5h17 C T 16: 58,820,909 (GRCm39) P287L probably damaging Het
Or9s13 T C 1: 92,548,404 (GRCm39) Y259H possibly damaging Het
Pgr T C 9: 8,946,639 (GRCm39) probably benign Het
Pik3c2g T A 6: 139,603,562 (GRCm39) C249* probably null Het
Plcd3 C T 11: 102,961,929 (GRCm39) V726M possibly damaging Het
Prl8a1 A G 13: 27,759,617 (GRCm39) L140P probably damaging Het
Prpf6 C A 2: 181,264,056 (GRCm39) D239E probably damaging Het
Rcc1 C T 4: 132,065,067 (GRCm39) R139H probably benign Het
Rimbp2 G T 5: 128,874,809 (GRCm39) Q268K probably damaging Het
Rps19-ps13 A T 18: 40,859,447 (GRCm39) noncoding transcript Het
Sema4c C A 1: 36,591,965 (GRCm39) G266V probably damaging Het
Sema4g T C 19: 44,985,150 (GRCm39) F156S probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Speer4f1 G T 5: 17,685,381 (GRCm39) L225F unknown Het
Thrap3 T C 4: 126,059,157 (GRCm39) probably benign Het
Tnfrsf8 T C 4: 144,995,568 (GRCm39) E497G probably benign Het
Trim45 C T 3: 100,838,943 (GRCm39) probably benign Het
Wdr43 A G 17: 71,949,731 (GRCm39) D445G probably benign Het
Other mutations in Trim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trim3 APN 7 105,266,676 (GRCm39) missense probably damaging 1.00
IGL01543:Trim3 APN 7 105,262,520 (GRCm39) missense probably damaging 1.00
IGL01573:Trim3 APN 7 105,274,700 (GRCm39) missense possibly damaging 0.62
IGL01995:Trim3 APN 7 105,267,689 (GRCm39) splice site probably benign
IGL02407:Trim3 APN 7 105,262,218 (GRCm39) missense probably benign 0.44
IGL02868:Trim3 APN 7 105,262,239 (GRCm39) missense possibly damaging 0.82
PIT4514001:Trim3 UTSW 7 105,267,417 (GRCm39) missense probably benign 0.08
R1013:Trim3 UTSW 7 105,267,102 (GRCm39) missense probably benign 0.10
R2296:Trim3 UTSW 7 105,262,481 (GRCm39) missense probably damaging 1.00
R3724:Trim3 UTSW 7 105,260,396 (GRCm39) missense probably damaging 1.00
R4028:Trim3 UTSW 7 105,267,452 (GRCm39) missense probably benign 0.04
R4347:Trim3 UTSW 7 105,268,594 (GRCm39) missense probably damaging 1.00
R4383:Trim3 UTSW 7 105,267,606 (GRCm39) missense probably damaging 1.00
R4475:Trim3 UTSW 7 105,267,009 (GRCm39) missense probably damaging 1.00
R4567:Trim3 UTSW 7 105,262,623 (GRCm39) missense possibly damaging 0.88
R4886:Trim3 UTSW 7 105,267,047 (GRCm39) missense probably damaging 1.00
R4981:Trim3 UTSW 7 105,268,335 (GRCm39) missense probably damaging 0.99
R5053:Trim3 UTSW 7 105,266,968 (GRCm39) missense probably damaging 1.00
R5190:Trim3 UTSW 7 105,268,716 (GRCm39) missense probably damaging 1.00
R5230:Trim3 UTSW 7 105,268,720 (GRCm39) missense possibly damaging 0.81
R5364:Trim3 UTSW 7 105,268,276 (GRCm39) missense probably damaging 0.96
R5382:Trim3 UTSW 7 105,267,554 (GRCm39) missense probably benign 0.10
R5712:Trim3 UTSW 7 105,268,743 (GRCm39) missense probably damaging 0.99
R5725:Trim3 UTSW 7 105,266,947 (GRCm39) critical splice donor site probably null
R5915:Trim3 UTSW 7 105,267,182 (GRCm39) missense possibly damaging 0.82
R6058:Trim3 UTSW 7 105,260,278 (GRCm39) missense probably damaging 0.98
R6073:Trim3 UTSW 7 105,266,746 (GRCm39) missense probably damaging 1.00
R6430:Trim3 UTSW 7 105,267,212 (GRCm39) missense probably benign 0.20
R6589:Trim3 UTSW 7 105,267,167 (GRCm39) missense probably damaging 1.00
R7044:Trim3 UTSW 7 105,267,421 (GRCm39) missense probably damaging 0.97
R7207:Trim3 UTSW 7 105,262,583 (GRCm39) missense possibly damaging 0.87
R7326:Trim3 UTSW 7 105,267,007 (GRCm39) nonsense probably null
R7454:Trim3 UTSW 7 105,268,765 (GRCm39) missense probably damaging 1.00
R7459:Trim3 UTSW 7 105,267,015 (GRCm39) missense probably damaging 1.00
R8044:Trim3 UTSW 7 105,262,465 (GRCm39) synonymous silent
R8202:Trim3 UTSW 7 105,260,632 (GRCm39) missense possibly damaging 0.68
R9343:Trim3 UTSW 7 105,260,673 (GRCm39) missense probably benign 0.10
R9667:Trim3 UTSW 7 105,267,455 (GRCm39) missense possibly damaging 0.78
R9775:Trim3 UTSW 7 105,260,377 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCCACGTAGGTCTGCTCC -3'
(R):5'- GCTGTAAAGGCCCCTTCTATATC -3'

Sequencing Primer
(F):5'- TCCAAGCACTGGGATTACTG -3'
(R):5'- GTAAAGGCCCCTTCTATATCTTGAC -3'
Posted On 2016-06-08