Incidental Mutation 'IGL02837:Ntsr2'
ID391928
Institutional Source Beutler Lab
Gene Symbol Ntsr2
Ensembl Gene ENSMUSG00000020591
Gene Nameneurotensin receptor 2
SynonymsNTRL, NT2R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #IGL02837 (G1)
Quality Score107
Status Validated
Chromosome12
Chromosomal Location16653382-16660227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16653875 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 126 (V126M)
Ref Sequence ENSEMBL: ENSMUSP00000106693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111064] [ENSMUST00000220892] [ENSMUST00000221049] [ENSMUST00000221596]
Predicted Effect probably damaging
Transcript: ENSMUST00000111064
AA Change: V126M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106693
Gene: ENSMUSG00000020591
AA Change: V126M

DomainStartEndE-ValueType
Pfam:7tm_1 49 358 4.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220892
AA Change: V126M

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000221049
AA Change: V40M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000221596
AA Change: V126M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222957
Meta Mutation Damage Score 0.1622 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit abnormal thermal nociception. Mice homozygous for different knock-out allele exhibit increased prepulse inhibition and decreased accoustic startle response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,957,581 V786I probably benign Het
Adamts13 A G 2: 26,991,420 N803S probably benign Het
Ago4 C G 4: 126,497,300 G730R possibly damaging Het
Amn T A 12: 111,271,899 M55K possibly damaging Het
Apob A T 12: 8,005,102 Y1334F probably damaging Het
Arl14ep A C 2: 106,969,229 L89R probably damaging Het
Bcam T G 7: 19,764,186 E304A probably damaging Het
Car10 A T 11: 93,597,251 Y258F probably damaging Het
Cerk T A 15: 86,144,695 K82* probably null Het
Chac2 T C 11: 30,977,496 N141S probably damaging Het
Clpx T G 9: 65,324,259 L556R probably damaging Het
Csgalnact2 T C 6: 118,124,403 I55V probably benign Het
Cul1 T C 6: 47,523,205 V650A probably benign Het
Dnah5 A T 15: 28,269,400 E895D probably benign Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Dpys A G 15: 39,857,305 S20P probably damaging Het
Fat1 G A 8: 45,017,434 V1490I probably benign Het
Flg2 T G 3: 93,201,737 C357W probably damaging Het
Flt1 T A 5: 147,655,170 D494V probably benign Het
Fpr-rs4 T A 17: 18,022,251 D173E probably benign Het
Gm2666 G T 1: 85,485,103 noncoding transcript Het
Gm3867 C A 9: 36,257,800 noncoding transcript Het
Gm5436 A T 12: 84,258,600 noncoding transcript Het
Kit G A 5: 75,639,008 V467I probably benign Het
Krtap4-16 A G 11: 99,851,037 V179A unknown Het
Lrp8 C A 4: 107,861,281 H693Q probably benign Het
Lrrc49 A G 9: 60,610,322 S75P probably benign Het
Ltbp4 C A 7: 27,314,381 V1068L probably damaging Het
Magel2 C T 7: 62,378,260 P304L possibly damaging Het
Muc19 T A 15: 91,882,656 noncoding transcript Het
Npas3 T C 12: 53,947,197 V175A possibly damaging Het
Nr1h4 A T 10: 89,516,480 H8Q probably benign Het
Odf2 A T 2: 29,926,713 T725S probably damaging Het
Olfr12 T C 1: 92,620,682 Y259H possibly damaging Het
Olfr183 C T 16: 59,000,546 P287L probably damaging Het
Olfr603 C T 7: 103,383,615 C129Y probably damaging Het
Pgr T C 9: 8,946,638 probably benign Het
Pik3c2g T A 6: 139,626,564 C249* probably null Het
Plcd3 C T 11: 103,071,103 V726M possibly damaging Het
Prl8a1 A G 13: 27,575,634 L140P probably damaging Het
Prpf6 C A 2: 181,622,263 D239E probably damaging Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Rimbp2 G T 5: 128,797,745 Q268K probably damaging Het
Rps19-ps13 A T 18: 40,726,394 noncoding transcript Het
Sema4c C A 1: 36,552,884 G266V probably damaging Het
Sema4g T C 19: 44,996,711 F156S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Speer4f1 G T 5: 17,480,383 L225F unknown Het
Thrap3 T C 4: 126,165,364 probably benign Het
Tnfrsf8 T C 4: 145,268,998 E497G probably benign Het
Trim3 T C 7: 105,612,656 N631S probably damaging Het
Trim45 C T 3: 100,931,627 probably benign Het
Wdr43 A G 17: 71,642,736 D445G probably benign Het
Other mutations in Ntsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Ntsr2 APN 12 16659848 missense probably damaging 0.97
IGL01973:Ntsr2 APN 12 16656774 missense probably benign 0.01
IGL02202:Ntsr2 APN 12 16653660 missense probably damaging 0.99
IGL02493:Ntsr2 APN 12 16658389 missense possibly damaging 0.90
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0381:Ntsr2 UTSW 12 16659718 nonsense probably null
R0437:Ntsr2 UTSW 12 16653695 missense probably damaging 1.00
R0666:Ntsr2 UTSW 12 16653980 missense probably benign 0.28
R0751:Ntsr2 UTSW 12 16654030 missense probably damaging 1.00
R1919:Ntsr2 UTSW 12 16654110 missense probably damaging 0.96
R2190:Ntsr2 UTSW 12 16654017 missense probably damaging 1.00
R5323:Ntsr2 UTSW 12 16659933 missense probably benign 0.00
R5358:Ntsr2 UTSW 12 16654082 missense probably damaging 1.00
R6282:Ntsr2 UTSW 12 16658425 missense probably damaging 1.00
R6358:Ntsr2 UTSW 12 16656768 missense probably benign 0.29
R6523:Ntsr2 UTSW 12 16656696 missense probably benign 0.05
R6837:Ntsr2 UTSW 12 16659709 missense probably benign 0.04
RF017:Ntsr2 UTSW 12 16659765 missense probably damaging 0.99
X0064:Ntsr2 UTSW 12 16656757 missense probably damaging 1.00
Z1177:Ntsr2 UTSW 12 16653662 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TTCCCAGAAAGGAGGTGGTG -3'
(R):5'- ACCTGGATGAAGACCTGGAG -3'

Sequencing Primer
(F):5'- ATCTTCGCGCTTGGCACAG -3'
(R):5'- TGGCGCGACTTACTAGCAC -3'
Posted On2016-06-08