Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL02835:A830018L16Rik'

391945

Institutional Source

Beutler Lab

Gene Symbol

A830018L16Rik

Ensembl Gene

ENSMUSG00000057715

Gene Name

RIKEN cDNA A830018L16 gene

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

IGL02835 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11414105-11975901 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 11972055 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 433 (D433A)

Ref Sequence

ENSEMBL: ENSMUSP00000117421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000137824] [ENSMUST00000179089]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048613
AA Change: D430A

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: D430A

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137824
AA Change: D433A

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: D433A

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179089
AA Change: D417A

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

not run
Transcript: ENSMUST00000185882
AA Change: D433A

Meta Mutation Damage Score

0.0637

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	A	8: 79,210,655	K208*	probably null	Het
A530016L24Rik	A	C	12: 112,494,986		probably null	Het
Abca13	T	A	11: 9,451,515	I3985N	probably damaging	Het
Abhd17c	C	T	7: 84,151,523	D108N	probably benign	Het
Adam29	C	T	8: 55,873,138	D94N	probably damaging	Het
Agr2	A	G	12: 35,995,904	D50G	probably benign	Het
Akap2	C	G	4: 57,883,044	P837A	probably damaging	Het
Angptl1	A	G	1: 156,858,520	D392G	probably benign	Het
Apob	A	G	12: 8,015,097	N3989S	possibly damaging	Het
AU018091	T	C	7: 3,169,071	D12G	unknown	Het
Cyfip2	A	T	11: 46,249,771	S742T	probably benign	Het
Dlc1	C	T	8: 36,583,901	S892N	probably damaging	Het
Dsg1b	A	G	18: 20,392,014	N169S	possibly damaging	Het
Egfem1	T	C	3: 29,657,241	L323P	probably damaging	Het
Emilin3	G	A	2: 160,908,729	Q320*	probably null	Het
Fjx1	G	A	2: 102,450,747	A281V	possibly damaging	Het
Fmn2	T	A	1: 174,582,059	D619E	unknown	Het
Gm13088	T	A	4: 143,654,247	Y402F	probably damaging	Het
Gm4795	A	C	10: 45,006,158		noncoding transcript	Het
Gm5117	T	C	8: 31,737,170		noncoding transcript	Het
Gm5250	T	C	1: 13,062,194		noncoding transcript	Het
Gtdc1	A	T	2: 44,756,312	Y101*	probably null	Het
Herc6	T	C	6: 57,646,161	I583T	possibly damaging	Het
Hyal4	G	A	6: 24,765,715	R356H	probably benign	Het
Il22ra2	C	A	10: 19,626,676	T81K	probably benign	Het
Iqcm	T	A	8: 75,554,883		probably benign	Het
Izumo4	G	A	10: 80,705,125	V220I	probably benign	Het
Kif16b	A	T	2: 142,712,213	D899E	probably benign	Het
Lrp2	A	T	2: 69,505,304	N1358K	probably damaging	Het
Lrrk2	A	G	15: 91,814,660		probably null	Het
Lyst	C	T	13: 13,661,100	T1789M	possibly damaging	Het
Map4k4	A	G	1: 40,010,600	T732A	probably damaging	Het
Mdh1b	A	T	1: 63,718,657	I305N	probably damaging	Het
Mettl13	A	G	1: 162,546,016	I222T	probably damaging	Het
Muc4	T	C	16: 32,763,945	F2583L	probably benign	Het
Nbea	C	T	3: 55,717,869	R2267Q	possibly damaging	Het
Ndfip1	T	C	18: 38,456,091	Y178H	probably damaging	Het
Nin	A	T	12: 70,056,738	F243I	probably damaging	Het
Nlrp10	A	T	7: 108,924,662	I537K	possibly damaging	Het
Nup155	T	C	15: 8,143,130	Y867H	probably damaging	Het
Pik3r4	A	C	9: 105,672,706	I999L	probably benign	Het
Pitpnm3	G	A	11: 72,061,466		probably benign	Het
Pkd1l2	G	A	8: 117,065,745	T436I	probably benign	Het
Polg2	A	T	11: 106,775,440	V293E	probably benign	Het
Prok1	T	C	3: 107,237,215		probably null	Het
Ptcd1	T	C	5: 145,154,690	D533G	possibly damaging	Het
Ptpn13	T	C	5: 103,560,025	V1484A	probably damaging	Het
Rapgef2	A	T	3: 79,092,986		probably benign	Het
Serpinb8	T	G	1: 107,602,856	F121L	probably damaging	Het
Sh3rf1	T	A	8: 61,226,047	V41E	probably damaging	Het
Snx13	A	G	12: 35,132,127	N725S	possibly damaging	Het
Soga1	G	A	2: 157,041,934	T363I	possibly damaging	Het
Stab1	A	T	14: 31,146,024		probably null	Het
Themis	A	T	10: 28,761,620		probably benign	Het
Trim68	T	A	7: 102,678,573	Y391F	probably benign	Het
Trmt1	T	G	8: 84,696,960	V327G	probably null	Het
Vill	C	T	9: 119,067,445	T120M	probably benign	Het

Other mutations in A830018L16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:A830018L16Rik	APN	1	11748054	missense	probably damaging	0.98
IGL01916:A830018L16Rik	APN	1	11748107	splice site	probably benign
IGL02040:A830018L16Rik	APN	1	11933598	intron	probably benign
IGL02432:A830018L16Rik	APN	1	11748079	missense	probably damaging	1.00
IGL02693:A830018L16Rik	APN	1	11596282	missense	probably damaging	1.00
IGL02736:A830018L16Rik	APN	1	11972051	missense	probably benign	0.02
IGL03293:A830018L16Rik	APN	1	11545151	splice site	probably null
R1203:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1216:A830018L16Rik	UTSW	1	11798492	missense	probably damaging	0.99
R1548:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1644:A830018L16Rik	UTSW	1	11414590	nonsense	probably null
R1855:A830018L16Rik	UTSW	1	11747971	missense	probably damaging	1.00
R1858:A830018L16Rik	UTSW	1	11974953	missense	unknown
R2265:A830018L16Rik	UTSW	1	11972104	critical splice donor site	probably null
R2296:A830018L16Rik	UTSW	1	11512051	missense	possibly damaging	0.94
R2484:A830018L16Rik	UTSW	1	11596302	missense	probably damaging	1.00
R3730:A830018L16Rik	UTSW	1	11545226	missense	probably damaging	1.00
R3752:A830018L16Rik	UTSW	1	11518680	missense	probably damaging	1.00
R3861:A830018L16Rik	UTSW	1	11588554	splice site	probably benign
R4305:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4306:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4307:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4558:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4598:A830018L16Rik	UTSW	1	11747964	critical splice acceptor site	probably null
R4652:A830018L16Rik	UTSW	1	11537342	intron	probably benign
R5492:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5493:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5802:A830018L16Rik	UTSW	1	11950964	missense	probably damaging	1.00
R6007:A830018L16Rik	UTSW	1	11511916	critical splice acceptor site	probably null
R6082:A830018L16Rik	UTSW	1	11798528	missense	probably benign	0.04
R6376:A830018L16Rik	UTSW	1	11798494	missense	probably damaging	0.98
R6453:A830018L16Rik	UTSW	1	11798558	missense	possibly damaging	0.91
R6757:A830018L16Rik	UTSW	1	11596334	makesense	probably null
R6833:A830018L16Rik	UTSW	1	11588509	missense	probably damaging	1.00
R7163:A830018L16Rik	UTSW	1	11414624	missense	probably damaging	0.96
R7272:A830018L16Rik	UTSW	1	11588471	missense	probably damaging	0.97
R7566:A830018L16Rik	UTSW	1	11951028	missense	probably damaging	1.00
R7665:A830018L16Rik	UTSW	1	11972099	missense	probably damaging	0.96
R8004:A830018L16Rik	UTSW	1	11951062	splice site	probably benign
Z1176:A830018L16Rik	UTSW	1	11518625	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCATGACAACTTACACACTGCTA -3'
(R):5'- CTGCTGTTGATAATAAATGCCTGTA -3'

Sequencing Primer
(F):5'- TACACAGTCAACATGCAGCTGG -3'
(R):5'- TTCCAAAGGCTGGCTGAATGC -3'

Posted On

2016-06-08