Incidental Mutation 'IGL02835:A830018L16Rik'
ID391945
Institutional Source Beutler Lab
Gene Symbol A830018L16Rik
Ensembl Gene ENSMUSG00000057715
Gene NameRIKEN cDNA A830018L16 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #IGL02835 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location11414105-11975901 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 11972055 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 433 (D433A)
Ref Sequence ENSEMBL: ENSMUSP00000117421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000137824] [ENSMUST00000179089]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048613
AA Change: D430A

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: D430A

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137824
AA Change: D433A

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: D433A

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179089
AA Change: D417A

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect not run
Transcript: ENSMUST00000185882
AA Change: D433A
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,210,655 K208* probably null Het
A530016L24Rik A C 12: 112,494,986 probably null Het
Abca13 T A 11: 9,451,515 I3985N probably damaging Het
Abhd17c C T 7: 84,151,523 D108N probably benign Het
Adam29 C T 8: 55,873,138 D94N probably damaging Het
Agr2 A G 12: 35,995,904 D50G probably benign Het
Akap2 C G 4: 57,883,044 P837A probably damaging Het
Angptl1 A G 1: 156,858,520 D392G probably benign Het
Apob A G 12: 8,015,097 N3989S possibly damaging Het
AU018091 T C 7: 3,169,071 D12G unknown Het
Cyfip2 A T 11: 46,249,771 S742T probably benign Het
Dlc1 C T 8: 36,583,901 S892N probably damaging Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Egfem1 T C 3: 29,657,241 L323P probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Fjx1 G A 2: 102,450,747 A281V possibly damaging Het
Fmn2 T A 1: 174,582,059 D619E unknown Het
Gm13088 T A 4: 143,654,247 Y402F probably damaging Het
Gm4795 A C 10: 45,006,158 noncoding transcript Het
Gm5117 T C 8: 31,737,170 noncoding transcript Het
Gm5250 T C 1: 13,062,194 noncoding transcript Het
Gtdc1 A T 2: 44,756,312 Y101* probably null Het
Herc6 T C 6: 57,646,161 I583T possibly damaging Het
Hyal4 G A 6: 24,765,715 R356H probably benign Het
Il22ra2 C A 10: 19,626,676 T81K probably benign Het
Iqcm T A 8: 75,554,883 probably benign Het
Izumo4 G A 10: 80,705,125 V220I probably benign Het
Kif16b A T 2: 142,712,213 D899E probably benign Het
Lrp2 A T 2: 69,505,304 N1358K probably damaging Het
Lrrk2 A G 15: 91,814,660 probably null Het
Lyst C T 13: 13,661,100 T1789M possibly damaging Het
Map4k4 A G 1: 40,010,600 T732A probably damaging Het
Mdh1b A T 1: 63,718,657 I305N probably damaging Het
Mettl13 A G 1: 162,546,016 I222T probably damaging Het
Muc4 T C 16: 32,763,945 F2583L probably benign Het
Nbea C T 3: 55,717,869 R2267Q possibly damaging Het
Ndfip1 T C 18: 38,456,091 Y178H probably damaging Het
Nin A T 12: 70,056,738 F243I probably damaging Het
Nlrp10 A T 7: 108,924,662 I537K possibly damaging Het
Nup155 T C 15: 8,143,130 Y867H probably damaging Het
Pik3r4 A C 9: 105,672,706 I999L probably benign Het
Pitpnm3 G A 11: 72,061,466 probably benign Het
Pkd1l2 G A 8: 117,065,745 T436I probably benign Het
Polg2 A T 11: 106,775,440 V293E probably benign Het
Prok1 T C 3: 107,237,215 probably null Het
Ptcd1 T C 5: 145,154,690 D533G possibly damaging Het
Ptpn13 T C 5: 103,560,025 V1484A probably damaging Het
Rapgef2 A T 3: 79,092,986 probably benign Het
Serpinb8 T G 1: 107,602,856 F121L probably damaging Het
Sh3rf1 T A 8: 61,226,047 V41E probably damaging Het
Snx13 A G 12: 35,132,127 N725S possibly damaging Het
Soga1 G A 2: 157,041,934 T363I possibly damaging Het
Stab1 A T 14: 31,146,024 probably null Het
Themis A T 10: 28,761,620 probably benign Het
Trim68 T A 7: 102,678,573 Y391F probably benign Het
Trmt1 T G 8: 84,696,960 V327G probably null Het
Vill C T 9: 119,067,445 T120M probably benign Het
Other mutations in A830018L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:A830018L16Rik APN 1 11748054 missense probably damaging 0.98
IGL01916:A830018L16Rik APN 1 11748107 splice site probably benign
IGL02040:A830018L16Rik APN 1 11933598 intron probably benign
IGL02432:A830018L16Rik APN 1 11748079 missense probably damaging 1.00
IGL02693:A830018L16Rik APN 1 11596282 missense probably damaging 1.00
IGL02736:A830018L16Rik APN 1 11972051 missense probably benign 0.02
IGL03293:A830018L16Rik APN 1 11545151 splice site probably null
R1203:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1216:A830018L16Rik UTSW 1 11798492 missense probably damaging 0.99
R1548:A830018L16Rik UTSW 1 11518594 missense probably damaging 1.00
R1644:A830018L16Rik UTSW 1 11414590 nonsense probably null
R1855:A830018L16Rik UTSW 1 11747971 missense probably damaging 1.00
R1858:A830018L16Rik UTSW 1 11974953 missense unknown
R2265:A830018L16Rik UTSW 1 11972104 critical splice donor site probably null
R2296:A830018L16Rik UTSW 1 11512051 missense possibly damaging 0.94
R2484:A830018L16Rik UTSW 1 11596302 missense probably damaging 1.00
R3730:A830018L16Rik UTSW 1 11545226 missense probably damaging 1.00
R3752:A830018L16Rik UTSW 1 11518680 missense probably damaging 1.00
R3861:A830018L16Rik UTSW 1 11588554 splice site probably benign
R4305:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4306:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4307:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4558:A830018L16Rik UTSW 1 11972076 nonsense probably null
R4598:A830018L16Rik UTSW 1 11747964 critical splice acceptor site probably null
R4652:A830018L16Rik UTSW 1 11537342 intron probably benign
R5492:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5493:A830018L16Rik UTSW 1 11545207 missense probably damaging 0.99
R5802:A830018L16Rik UTSW 1 11950964 missense probably damaging 1.00
R6007:A830018L16Rik UTSW 1 11511916 critical splice acceptor site probably null
R6082:A830018L16Rik UTSW 1 11798528 missense probably benign 0.04
R6376:A830018L16Rik UTSW 1 11798494 missense probably damaging 0.98
R6453:A830018L16Rik UTSW 1 11798558 missense possibly damaging 0.91
R6757:A830018L16Rik UTSW 1 11596334 makesense probably null
R6833:A830018L16Rik UTSW 1 11588509 missense probably damaging 1.00
R7163:A830018L16Rik UTSW 1 11414624 missense probably damaging 0.96
R7272:A830018L16Rik UTSW 1 11588471 missense probably damaging 0.97
R7566:A830018L16Rik UTSW 1 11951028 missense probably damaging 1.00
R7665:A830018L16Rik UTSW 1 11972099 missense probably damaging 0.96
R8004:A830018L16Rik UTSW 1 11951062 splice site probably benign
Z1176:A830018L16Rik UTSW 1 11518625 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATGACAACTTACACACTGCTA -3'
(R):5'- CTGCTGTTGATAATAAATGCCTGTA -3'

Sequencing Primer
(F):5'- TACACAGTCAACATGCAGCTGG -3'
(R):5'- TTCCAAAGGCTGGCTGAATGC -3'
Posted On2016-06-08