Mutagenetix > Incidental Mutation

Incidental Mutation 'R0441:Epg5'

39195

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

038642-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.916) question?

Stock #

R0441 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 78023271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

AlphaFold

Q80TA9

Predicted Effect

probably benign
Transcript: ENSMUST00000044622

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	T	C	4: 103,235,492		probably benign	Het
Adgrv1	G	A	13: 81,397,226	R5647*	probably null	Het
Agbl2	C	T	2: 90,797,483	R211*	probably null	Het
Akap9	A	G	5: 3,961,714	K806E	probably benign	Het
Ampd1	C	G	3: 103,088,478	L235V	probably benign	Het
Atcay	T	C	10: 81,224,460	D14G	possibly damaging	Het
Atp8b4	C	T	2: 126,378,706		probably benign	Het
Bmp8b	T	C	4: 123,124,515	V393A	probably damaging	Het
Brca2	T	A	5: 150,541,857	D1695E	probably damaging	Het
Cdh15	A	G	8: 122,860,966	I210V	probably damaging	Het
Cep250	T	C	2: 155,972,004	L564P	possibly damaging	Het
Cmpk1	T	C	4: 114,965,023	T110A	probably benign	Het
Cpsf3	T	G	12: 21,300,084	I268S	probably damaging	Het
Csmd2	C	T	4: 128,520,230	A2621V	probably benign	Het
Cyp2c40	T	C	19: 39,807,163		probably benign	Het
D430041D05Rik	T	A	2: 104,167,947	Y1837F	probably damaging	Het
Degs2	A	G	12: 108,702,214	F10S	probably damaging	Het
Dytn	T	A	1: 63,678,774		probably benign	Het
Elfn2	G	C	15: 78,673,595	P251A	probably benign	Het
Evc2	A	G	5: 37,417,467	D1022G	probably damaging	Het
Fat3	A	G	9: 15,945,008		probably benign	Het
Fbn1	A	T	2: 125,309,755		probably null	Het
Gm15217	T	C	14: 46,383,219		probably null	Het
Gm17611	A	T	13: 49,976,399		noncoding transcript	Het
Gpld1	G	A	13: 24,962,320	W182*	probably null	Het
Gsc	T	C	12: 104,473,094	I8V	probably damaging	Het
Hck	A	G	2: 153,134,132	K197R	probably benign	Het
Kat6b	T	C	14: 21,670,233	L1551P	probably damaging	Het
Lrch1	C	T	14: 74,947,545	G39D	possibly damaging	Het
Macf1	T	C	4: 123,365,355		probably null	Het
Mroh9	A	T	1: 163,060,762	V248E	probably damaging	Het
Mrps15	C	A	4: 126,051,417		probably benign	Het
Mum1	A	T	10: 80,229,025	N30Y	probably damaging	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Ndufa5	T	C	6: 24,522,751	T31A	probably benign	Het
Nfyb	A	G	10: 82,750,760	V190A	possibly damaging	Het
Nos2	A	G	11: 78,928,583	I40M	probably benign	Het
Olfr1019	A	T	2: 85,841,515	I92N	probably damaging	Het
Olfr1084	A	T	2: 86,639,330	I126K	probably damaging	Het
Olfr452	T	C	6: 42,790,174	I45T	probably damaging	Het
Otog	T	C	7: 46,305,877	S564P	probably damaging	Het
Pak7	C	T	2: 136,116,629	A180T	probably benign	Het
Pappa2	T	C	1: 158,763,058		probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plxnc1	T	A	10: 94,796,482	N1431I	probably damaging	Het
Prph	A	T	15: 99,057,438	I429L	probably damaging	Het
Prrc2a	A	G	17: 35,149,688		probably benign	Het
Rad54b	A	T	4: 11,563,394	T18S	probably benign	Het
Ranbp2	A	G	10: 58,485,768	E2629G	probably benign	Het
Rec114	G	A	9: 58,657,770	T201I	probably benign	Het
Rspo1	G	A	4: 124,991,397	R22Q	probably benign	Het
Sec23b	A	G	2: 144,581,997	E522G	probably damaging	Het
Sgsm3	G	A	15: 81,009,770	R502H	possibly damaging	Het
Sh3pxd2b	C	A	11: 32,423,023	A730D	possibly damaging	Het
Spag4	A	G	2: 156,067,979	D187G	probably damaging	Het
Srgap2	G	A	1: 131,336,437	T465I	probably damaging	Het
St3gal6	C	A	16: 58,473,453	A238S	probably damaging	Het
St3gal6	G	T	16: 58,473,455	A237E	probably damaging	Het
Tecpr1	C	A	5: 144,195,941	R1159L	probably benign	Het
Tmem63b	A	T	17: 45,666,315		probably null	Het
Tmtc1	T	A	6: 148,415,758	D78V	probably damaging	Het
Tpp2	A	G	1: 43,990,562	N68D	possibly damaging	Het
Ttn	C	A	2: 76,939,925	A2641S	probably benign	Het
Uimc1	T	C	13: 55,093,219	K19E	probably damaging	Het
Utrn	T	A	10: 12,688,294	E1274V	probably null	Het
Vmn2r102	A	T	17: 19,694,368	I732F	probably damaging	Het
Wrn	A	T	8: 33,268,750	M792K	probably benign	Het
Zfp451	A	G	1: 33,777,045	I608T	probably damaging	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8124:Epg5	UTSW	18	77964996	missense	probably benign	0.05
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
R8751:Epg5	UTSW	18	77965008	missense	probably benign	0.07
R8751:Epg5	UTSW	18	77965009	missense	possibly damaging	0.65
R8751:Epg5	UTSW	18	77965010	missense	probably benign	0.28
R8888:Epg5	UTSW	18	78012871	missense	possibly damaging	0.76
R8971:Epg5	UTSW	18	77979219	missense	probably damaging	1.00
R9045:Epg5	UTSW	18	77948799	missense	probably damaging	1.00
R9291:Epg5	UTSW	18	78012850	nonsense	probably null
R9327:Epg5	UTSW	18	77948220	missense	probably benign	0.00
R9365:Epg5	UTSW	18	77954742	missense	probably damaging	1.00
R9742:Epg5	UTSW	18	77980955	missense	probably damaging	1.00
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTAACTCGGCACATAAGCTGGAC -3'
(R):5'- CGAGGAACAGTCATTTGCCAGGAC -3'

Sequencing Primer
(F):5'- TCAAGGGAGCCTCACTGAATTAG -3'
(R):5'- TTTGCCAGGACGACGGATG -3'

Posted On

2013-05-23