Incidental Mutation 'IGL02835:Hyal4'
ID 391968
Institutional Source Beutler Lab
Gene Symbol Hyal4
Ensembl Gene ENSMUSG00000029680
Gene Name hyaluronoglucosaminidase 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # IGL02835 (G1)
Quality Score 183
Status Validated
Chromosome 6
Chromosomal Location 24748329-24767662 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24765715 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 356 (R356H)
Ref Sequence ENSEMBL: ENSMUSP00000031691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031691]
AlphaFold Q05A56
Predicted Effect probably benign
Transcript: ENSMUST00000031691
AA Change: R356H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: R356H

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,210,655 K208* probably null Het
A530016L24Rik A C 12: 112,494,986 probably null Het
A830018L16Rik A C 1: 11,972,055 D433A possibly damaging Het
Abca13 T A 11: 9,451,515 I3985N probably damaging Het
Abhd17c C T 7: 84,151,523 D108N probably benign Het
Adam29 C T 8: 55,873,138 D94N probably damaging Het
Agr2 A G 12: 35,995,904 D50G probably benign Het
Akap2 C G 4: 57,883,044 P837A probably damaging Het
Angptl1 A G 1: 156,858,520 D392G probably benign Het
Apob A G 12: 8,015,097 N3989S possibly damaging Het
AU018091 T C 7: 3,169,071 D12G unknown Het
Cyfip2 A T 11: 46,249,771 S742T probably benign Het
Dlc1 C T 8: 36,583,901 S892N probably damaging Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Egfem1 T C 3: 29,657,241 L323P probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Fjx1 G A 2: 102,450,747 A281V possibly damaging Het
Fmn2 T A 1: 174,582,059 D619E unknown Het
Gm13088 T A 4: 143,654,247 Y402F probably damaging Het
Gm4795 A C 10: 45,006,158 noncoding transcript Het
Gm5117 T C 8: 31,737,170 noncoding transcript Het
Gm5250 T C 1: 13,062,194 noncoding transcript Het
Gtdc1 A T 2: 44,756,312 Y101* probably null Het
Herc6 T C 6: 57,646,161 I583T possibly damaging Het
Il22ra2 C A 10: 19,626,676 T81K probably benign Het
Iqcm T A 8: 75,554,883 probably benign Het
Izumo4 G A 10: 80,705,125 V220I probably benign Het
Kif16b A T 2: 142,712,213 D899E probably benign Het
Lrp2 A T 2: 69,505,304 N1358K probably damaging Het
Lrrk2 A G 15: 91,814,660 probably null Het
Lyst C T 13: 13,661,100 T1789M possibly damaging Het
Map4k4 A G 1: 40,010,600 T732A probably damaging Het
Mdh1b A T 1: 63,718,657 I305N probably damaging Het
Mettl13 A G 1: 162,546,016 I222T probably damaging Het
Muc4 T C 16: 32,763,945 F2583L probably benign Het
Nbea C T 3: 55,717,869 R2267Q possibly damaging Het
Ndfip1 T C 18: 38,456,091 Y178H probably damaging Het
Nin A T 12: 70,056,738 F243I probably damaging Het
Nlrp10 A T 7: 108,924,662 I537K possibly damaging Het
Nup155 T C 15: 8,143,130 Y867H probably damaging Het
Pik3r4 A C 9: 105,672,706 I999L probably benign Het
Pitpnm3 G A 11: 72,061,466 probably benign Het
Pkd1l2 G A 8: 117,065,745 T436I probably benign Het
Polg2 A T 11: 106,775,440 V293E probably benign Het
Prok1 T C 3: 107,237,215 probably null Het
Ptcd1 T C 5: 145,154,690 D533G possibly damaging Het
Ptpn13 T C 5: 103,560,025 V1484A probably damaging Het
Rapgef2 A T 3: 79,092,986 probably benign Het
Serpinb8 T G 1: 107,602,856 F121L probably damaging Het
Sh3rf1 T A 8: 61,226,047 V41E probably damaging Het
Snx13 A G 12: 35,132,127 N725S possibly damaging Het
Soga1 G A 2: 157,041,934 T363I possibly damaging Het
Stab1 A T 14: 31,146,024 probably null Het
Themis A T 10: 28,761,620 probably benign Het
Trim68 T A 7: 102,678,573 Y391F probably benign Het
Trmt1 T G 8: 84,696,960 V327G probably null Het
Vill C T 9: 119,067,445 T120M probably benign Het
Other mutations in Hyal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Hyal4 APN 6 24755872 missense probably benign 0.03
IGL01791:Hyal4 APN 6 24763895 splice site probably benign
IGL02434:Hyal4 APN 6 24763858 nonsense probably null
IGL02523:Hyal4 APN 6 24765969 missense probably damaging 0.96
IGL03114:Hyal4 APN 6 24755965 missense probably benign 0.00
PIT4494001:Hyal4 UTSW 6 24755834 missense probably benign 0.05
R0196:Hyal4 UTSW 6 24756221 missense probably damaging 1.00
R0323:Hyal4 UTSW 6 24756194 missense probably benign 0.30
R0398:Hyal4 UTSW 6 24756671 missense probably damaging 0.97
R0946:Hyal4 UTSW 6 24755913 nonsense probably null
R0961:Hyal4 UTSW 6 24755746 utr 5 prime probably benign
R1906:Hyal4 UTSW 6 24756111 missense probably damaging 1.00
R1998:Hyal4 UTSW 6 24756311 missense probably benign 0.00
R2085:Hyal4 UTSW 6 24755750 start gained probably benign
R2483:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3622:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3623:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3624:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3712:Hyal4 UTSW 6 24756514 missense probably damaging 1.00
R4031:Hyal4 UTSW 6 24756224 missense probably damaging 1.00
R5762:Hyal4 UTSW 6 24765862 missense possibly damaging 0.93
R6177:Hyal4 UTSW 6 24766090 nonsense probably null
R6442:Hyal4 UTSW 6 24765850 missense probably benign 0.08
R6494:Hyal4 UTSW 6 24765746 missense possibly damaging 0.79
R6901:Hyal4 UTSW 6 24756191 missense probably damaging 0.97
R7565:Hyal4 UTSW 6 24765934 missense possibly damaging 0.77
R7973:Hyal4 UTSW 6 24755786 start codon destroyed probably null 0.99
R7977:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R7987:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R8020:Hyal4 UTSW 6 24755996 missense probably benign 0.14
R8676:Hyal4 UTSW 6 24755827 missense probably damaging 0.99
R9331:Hyal4 UTSW 6 24765867 missense probably damaging 1.00
R9573:Hyal4 UTSW 6 24756509 missense not run
Z1176:Hyal4 UTSW 6 24756628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTAGCTTGCTGGTTCAG -3'
(R):5'- ATCCTCAGAGGCCTCTATGTGG -3'

Sequencing Primer
(F):5'- GGTTCAGCTACTTTGACTAACTAGGC -3'
(R):5'- CTCAGAGGCCTCTATGTGGTAACTTG -3'
Posted On 2016-06-08