Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL02835:Pik3r4'

391981

Institutional Source

Beutler Lab

Gene Symbol

Pik3r4

Ensembl Gene

ENSMUSG00000032571

Gene Name

phosphoinositide-3-kinase regulatory subunit 4

Synonyms

D9Ertd418e, 2210010O15Rik, C730038E05Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

IGL02835 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

105642978-105687657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 105672706 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 999 (I999L)

Ref Sequence

ENSEMBL: ENSMUSP00000139427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000186943] [ENSMUST00000191268]

Predicted Effect

probably benign
Transcript: ENSMUST00000065778
AA Change: I999L

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: I999L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	1.7e-5	PFAM
Pfam:Pkinase	26	312	1.2e-18	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122710

Predicted Effect

probably benign
Transcript: ENSMUST00000186943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187573

Predicted Effect

probably benign
Transcript: ENSMUST00000191268
AA Change: I999L

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: I999L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	8.9e-7	PFAM
Pfam:Pkinase	26	312	3.7e-23	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Meta Mutation Damage Score

0.1001

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (57/58)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	A	8: 79,210,655	K208*	probably null	Het
A530016L24Rik	A	C	12: 112,494,986		probably null	Het
A830018L16Rik	A	C	1: 11,972,055	D433A	possibly damaging	Het
Abca13	T	A	11: 9,451,515	I3985N	probably damaging	Het
Abhd17c	C	T	7: 84,151,523	D108N	probably benign	Het
Adam29	C	T	8: 55,873,138	D94N	probably damaging	Het
Agr2	A	G	12: 35,995,904	D50G	probably benign	Het
Akap2	C	G	4: 57,883,044	P837A	probably damaging	Het
Angptl1	A	G	1: 156,858,520	D392G	probably benign	Het
Apob	A	G	12: 8,015,097	N3989S	possibly damaging	Het
AU018091	T	C	7: 3,169,071	D12G	unknown	Het
Cyfip2	A	T	11: 46,249,771	S742T	probably benign	Het
Dlc1	C	T	8: 36,583,901	S892N	probably damaging	Het
Dsg1b	A	G	18: 20,392,014	N169S	possibly damaging	Het
Egfem1	T	C	3: 29,657,241	L323P	probably damaging	Het
Emilin3	G	A	2: 160,908,729	Q320*	probably null	Het
Fjx1	G	A	2: 102,450,747	A281V	possibly damaging	Het
Fmn2	T	A	1: 174,582,059	D619E	unknown	Het
Gm13088	T	A	4: 143,654,247	Y402F	probably damaging	Het
Gm4795	A	C	10: 45,006,158		noncoding transcript	Het
Gm5117	T	C	8: 31,737,170		noncoding transcript	Het
Gm5250	T	C	1: 13,062,194		noncoding transcript	Het
Gtdc1	A	T	2: 44,756,312	Y101*	probably null	Het
Herc6	T	C	6: 57,646,161	I583T	possibly damaging	Het
Hyal4	G	A	6: 24,765,715	R356H	probably benign	Het
Il22ra2	C	A	10: 19,626,676	T81K	probably benign	Het
Iqcm	T	A	8: 75,554,883		probably benign	Het
Izumo4	G	A	10: 80,705,125	V220I	probably benign	Het
Kif16b	A	T	2: 142,712,213	D899E	probably benign	Het
Lrp2	A	T	2: 69,505,304	N1358K	probably damaging	Het
Lrrk2	A	G	15: 91,814,660		probably null	Het
Lyst	C	T	13: 13,661,100	T1789M	possibly damaging	Het
Map4k4	A	G	1: 40,010,600	T732A	probably damaging	Het
Mdh1b	A	T	1: 63,718,657	I305N	probably damaging	Het
Mettl13	A	G	1: 162,546,016	I222T	probably damaging	Het
Muc4	T	C	16: 32,763,945	F2583L	probably benign	Het
Nbea	C	T	3: 55,717,869	R2267Q	possibly damaging	Het
Ndfip1	T	C	18: 38,456,091	Y178H	probably damaging	Het
Nin	A	T	12: 70,056,738	F243I	probably damaging	Het
Nlrp10	A	T	7: 108,924,662	I537K	possibly damaging	Het
Nup155	T	C	15: 8,143,130	Y867H	probably damaging	Het
Pitpnm3	G	A	11: 72,061,466		probably benign	Het
Pkd1l2	G	A	8: 117,065,745	T436I	probably benign	Het
Polg2	A	T	11: 106,775,440	V293E	probably benign	Het
Prok1	T	C	3: 107,237,215		probably null	Het
Ptcd1	T	C	5: 145,154,690	D533G	possibly damaging	Het
Ptpn13	T	C	5: 103,560,025	V1484A	probably damaging	Het
Rapgef2	A	T	3: 79,092,986		probably benign	Het
Serpinb8	T	G	1: 107,602,856	F121L	probably damaging	Het
Sh3rf1	T	A	8: 61,226,047	V41E	probably damaging	Het
Snx13	A	G	12: 35,132,127	N725S	possibly damaging	Het
Soga1	G	A	2: 157,041,934	T363I	possibly damaging	Het
Stab1	A	T	14: 31,146,024		probably null	Het
Themis	A	T	10: 28,761,620		probably benign	Het
Trim68	T	A	7: 102,678,573	Y391F	probably benign	Het
Trmt1	T	G	8: 84,696,960	V327G	probably null	Het
Vill	C	T	9: 119,067,445	T120M	probably benign	Het

Other mutations in Pik3r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Pik3r4	APN	9	105644604	missense	possibly damaging	0.75
IGL01617:Pik3r4	APN	9	105654965	missense	probably benign	0.33
IGL01764:Pik3r4	APN	9	105685122	splice site	probably benign
IGL01817:Pik3r4	APN	9	105650822	missense	probably damaging	1.00
IGL01830:Pik3r4	APN	9	105644955	missense	probably damaging	1.00
IGL01905:Pik3r4	APN	9	105644878	nonsense	probably null
IGL01947:Pik3r4	APN	9	105686150	missense	possibly damaging	0.91
IGL01985:Pik3r4	APN	9	105663045	missense	probably benign	0.03
IGL02321:Pik3r4	APN	9	105644478	missense	probably benign	0.04
IGL02389:Pik3r4	APN	9	105650331	missense	possibly damaging	0.88
IGL02898:Pik3r4	APN	9	105650406	missense	probably benign	0.21
IGL03037:Pik3r4	APN	9	105650813	missense	probably damaging	1.00
boteh	UTSW	9	105667938	splice site	probably null
R0011:Pik3r4	UTSW	9	105644637	missense	probably benign	0.01
R0312:Pik3r4	UTSW	9	105686210	missense	probably damaging	1.00
R0321:Pik3r4	UTSW	9	105648707	missense	probably damaging	1.00
R0482:Pik3r4	UTSW	9	105669045	missense	probably benign	0.04
R0645:Pik3r4	UTSW	9	105669187	splice site	probably benign
R0690:Pik3r4	UTSW	9	105653976	missense	possibly damaging	0.81
R0789:Pik3r4	UTSW	9	105685167	missense	probably benign	0.14
R0894:Pik3r4	UTSW	9	105667771	missense	possibly damaging	0.73
R0988:Pik3r4	UTSW	9	105687205	missense	probably damaging	0.97
R1123:Pik3r4	UTSW	9	105663129	missense	probably benign
R1172:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1174:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1342:Pik3r4	UTSW	9	105650901	critical splice donor site	probably null
R1387:Pik3r4	UTSW	9	105644291	missense	probably damaging	1.00
R1480:Pik3r4	UTSW	9	105687244	missense	probably benign	0.39
R1638:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R1643:Pik3r4	UTSW	9	105687152	missense	possibly damaging	0.83
R1995:Pik3r4	UTSW	9	105669165	missense	probably benign	0.12
R2037:Pik3r4	UTSW	9	105650335	missense	probably benign	0.00
R2165:Pik3r4	UTSW	9	105672785	missense	probably benign	0.05
R4210:Pik3r4	UTSW	9	105650758	missense	possibly damaging	0.57
R4515:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4519:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4630:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4632:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4732:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4733:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4940:Pik3r4	UTSW	9	105668994	missense	probably benign	0.20
R5120:Pik3r4	UTSW	9	105669009	missense	probably benign	0.30
R5169:Pik3r4	UTSW	9	105678161	missense	probably benign	0.14
R5183:Pik3r4	UTSW	9	105682308	missense	possibly damaging	0.87
R5353:Pik3r4	UTSW	9	105667938	splice site	probably null
R5463:Pik3r4	UTSW	9	105648731	missense	probably damaging	1.00
R5635:Pik3r4	UTSW	9	105667825	missense	probably benign	0.01
R5763:Pik3r4	UTSW	9	105669775	missense	probably benign	0.01
R5830:Pik3r4	UTSW	9	105644824	nonsense	probably null
R6251:Pik3r4	UTSW	9	105654048	missense	probably benign
R6468:Pik3r4	UTSW	9	105685190	missense	possibly damaging	0.86
R6611:Pik3r4	UTSW	9	105644277	missense	probably damaging	0.99
R6642:Pik3r4	UTSW	9	105644646	missense	probably benign	0.11
R6821:Pik3r4	UTSW	9	105650606	missense	probably damaging	0.98
R7039:Pik3r4	UTSW	9	105676890	missense	possibly damaging	0.76
R7144:Pik3r4	UTSW	9	105650584	missense	probably damaging	0.98
R7410:Pik3r4	UTSW	9	105650591	missense	probably damaging	0.99
R7559:Pik3r4	UTSW	9	105678153	missense	probably benign	0.17
R7561:Pik3r4	UTSW	9	105687247	missense	possibly damaging	0.94
R7658:Pik3r4	UTSW	9	105644511	missense	probably damaging	0.98
R7727:Pik3r4	UTSW	9	105669882	missense	probably damaging	0.99
R7871:Pik3r4	UTSW	9	105663117	missense	probably damaging	1.00
R7954:Pik3r4	UTSW	9	105663117	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTATGTCATGGTCCAGTAG -3'
(R):5'- GCCCTAAGCAGCTCTGATAC -3'

Sequencing Primer
(F):5'- TCCAGTAGACCCCTCTGGATG -3'
(R):5'- TCTGATACAGAGAGAGCATTCTGC -3'

Posted On

2016-06-08