Incidental Mutation 'IGL02835:Il22ra2'
ID391984
Institutional Source Beutler Lab
Gene Symbol Il22ra2
Ensembl Gene ENSMUSG00000039760
Gene Nameinterleukin 22 receptor, alpha 2
SynonymsIl-22bp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02835 (G1)
Quality Score189
Status Validated
Chromosome10
Chromosomal Location19621998-19634681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19626676 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 81 (T81K)
Ref Sequence ENSEMBL: ENSMUSP00000042642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036564]
Predicted Effect probably benign
Transcript: ENSMUST00000036564
AA Change: T81K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000042642
Gene: ENSMUSG00000039760
AA Change: T81K

DomainStartEndE-ValueType
Pfam:Tissue_fac 6 113 3.4e-37 PFAM
Pfam:Interfer-bind 125 230 1.4e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class II cytokine receptor family. The encoded soluble protein specifically binds to and inhibits interleukin 22 activity by blocking the interaction of interleukin 22 with its cell surface receptor. The encoded protein may be important in the regulation of inflammatory response, and has been implicated in the regulation of tumorigenesis in the colon. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display accelerated tumor formation in a colitis associated colon cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,210,655 K208* probably null Het
A530016L24Rik A C 12: 112,494,986 probably null Het
A830018L16Rik A C 1: 11,972,055 D433A possibly damaging Het
Abca13 T A 11: 9,451,515 I3985N probably damaging Het
Abhd17c C T 7: 84,151,523 D108N probably benign Het
Adam29 C T 8: 55,873,138 D94N probably damaging Het
Agr2 A G 12: 35,995,904 D50G probably benign Het
Akap2 C G 4: 57,883,044 P837A probably damaging Het
Angptl1 A G 1: 156,858,520 D392G probably benign Het
Apob A G 12: 8,015,097 N3989S possibly damaging Het
AU018091 T C 7: 3,169,071 D12G unknown Het
Cyfip2 A T 11: 46,249,771 S742T probably benign Het
Dlc1 C T 8: 36,583,901 S892N probably damaging Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Egfem1 T C 3: 29,657,241 L323P probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Fjx1 G A 2: 102,450,747 A281V possibly damaging Het
Fmn2 T A 1: 174,582,059 D619E unknown Het
Gm13088 T A 4: 143,654,247 Y402F probably damaging Het
Gm4795 A C 10: 45,006,158 noncoding transcript Het
Gm5117 T C 8: 31,737,170 noncoding transcript Het
Gm5250 T C 1: 13,062,194 noncoding transcript Het
Gtdc1 A T 2: 44,756,312 Y101* probably null Het
Herc6 T C 6: 57,646,161 I583T possibly damaging Het
Hyal4 G A 6: 24,765,715 R356H probably benign Het
Iqcm T A 8: 75,554,883 probably benign Het
Izumo4 G A 10: 80,705,125 V220I probably benign Het
Kif16b A T 2: 142,712,213 D899E probably benign Het
Lrp2 A T 2: 69,505,304 N1358K probably damaging Het
Lrrk2 A G 15: 91,814,660 probably null Het
Lyst C T 13: 13,661,100 T1789M possibly damaging Het
Map4k4 A G 1: 40,010,600 T732A probably damaging Het
Mdh1b A T 1: 63,718,657 I305N probably damaging Het
Mettl13 A G 1: 162,546,016 I222T probably damaging Het
Muc4 T C 16: 32,763,945 F2583L probably benign Het
Nbea C T 3: 55,717,869 R2267Q possibly damaging Het
Ndfip1 T C 18: 38,456,091 Y178H probably damaging Het
Nin A T 12: 70,056,738 F243I probably damaging Het
Nlrp10 A T 7: 108,924,662 I537K possibly damaging Het
Nup155 T C 15: 8,143,130 Y867H probably damaging Het
Pik3r4 A C 9: 105,672,706 I999L probably benign Het
Pitpnm3 G A 11: 72,061,466 probably benign Het
Pkd1l2 G A 8: 117,065,745 T436I probably benign Het
Polg2 A T 11: 106,775,440 V293E probably benign Het
Prok1 T C 3: 107,237,215 probably null Het
Ptcd1 T C 5: 145,154,690 D533G possibly damaging Het
Ptpn13 T C 5: 103,560,025 V1484A probably damaging Het
Rapgef2 A T 3: 79,092,986 probably benign Het
Serpinb8 T G 1: 107,602,856 F121L probably damaging Het
Sh3rf1 T A 8: 61,226,047 V41E probably damaging Het
Snx13 A G 12: 35,132,127 N725S possibly damaging Het
Soga1 G A 2: 157,041,934 T363I possibly damaging Het
Stab1 A T 14: 31,146,024 probably null Het
Themis A T 10: 28,761,620 probably benign Het
Trim68 T A 7: 102,678,573 Y391F probably benign Het
Trmt1 T G 8: 84,696,960 V327G probably null Het
Vill C T 9: 119,067,445 T120M probably benign Het
Other mutations in Il22ra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Il22ra2 APN 10 19626744 missense probably benign 0.04
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R1687:Il22ra2 UTSW 10 19632872 missense probably benign 0.09
R1802:Il22ra2 UTSW 10 19626699 missense probably damaging 0.98
R2138:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R2139:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R3936:Il22ra2 UTSW 10 19631708 missense probably benign 0.00
R4063:Il22ra2 UTSW 10 19626652 missense possibly damaging 0.88
R4559:Il22ra2 UTSW 10 19626712 missense possibly damaging 0.90
R7578:Il22ra2 UTSW 10 19631624 missense probably benign 0.10
R7661:Il22ra2 UTSW 10 19622078 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTGGTTAGCGTGAAGGAAC -3'
(R):5'- AGATGAGAGCAAGTGTCTCG -3'

Sequencing Primer
(F):5'- GAGTCCTCAGATGGTAGAGAA -3'
(R):5'- CGACCATCCAGAGTTTGTTCAAAGG -3'
Posted On2016-06-08