Incidental Mutation 'IGL02835:A530016L24Rik'
ID 391994
Institutional Source Beutler Lab
Gene Symbol A530016L24Rik
Ensembl Gene ENSMUSG00000043122
Gene Name RIKEN cDNA A530016L24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.017) question?
Stock # IGL02835 (G1)
Quality Score 153
Status Validated
Chromosome 12
Chromosomal Location 112489448-112499927 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to C at 112494986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057465] [ENSMUST00000223266]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000057465
SMART Domains Protein: ENSMUSP00000056220
Gene: ENSMUSG00000043122

DomainStartEndE-ValueType
Pfam:DUF4658 32 165 4e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000223266
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,210,655 K208* probably null Het
A830018L16Rik A C 1: 11,972,055 D433A possibly damaging Het
Abca13 T A 11: 9,451,515 I3985N probably damaging Het
Abhd17c C T 7: 84,151,523 D108N probably benign Het
Adam29 C T 8: 55,873,138 D94N probably damaging Het
Agr2 A G 12: 35,995,904 D50G probably benign Het
Akap2 C G 4: 57,883,044 P837A probably damaging Het
Angptl1 A G 1: 156,858,520 D392G probably benign Het
Apob A G 12: 8,015,097 N3989S possibly damaging Het
AU018091 T C 7: 3,169,071 D12G unknown Het
Cyfip2 A T 11: 46,249,771 S742T probably benign Het
Dlc1 C T 8: 36,583,901 S892N probably damaging Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Egfem1 T C 3: 29,657,241 L323P probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Fjx1 G A 2: 102,450,747 A281V possibly damaging Het
Fmn2 T A 1: 174,582,059 D619E unknown Het
Gm13088 T A 4: 143,654,247 Y402F probably damaging Het
Gm4795 A C 10: 45,006,158 noncoding transcript Het
Gm5117 T C 8: 31,737,170 noncoding transcript Het
Gm5250 T C 1: 13,062,194 noncoding transcript Het
Gtdc1 A T 2: 44,756,312 Y101* probably null Het
Herc6 T C 6: 57,646,161 I583T possibly damaging Het
Hyal4 G A 6: 24,765,715 R356H probably benign Het
Il22ra2 C A 10: 19,626,676 T81K probably benign Het
Iqcm T A 8: 75,554,883 probably benign Het
Izumo4 G A 10: 80,705,125 V220I probably benign Het
Kif16b A T 2: 142,712,213 D899E probably benign Het
Lrp2 A T 2: 69,505,304 N1358K probably damaging Het
Lrrk2 A G 15: 91,814,660 probably null Het
Lyst C T 13: 13,661,100 T1789M possibly damaging Het
Map4k4 A G 1: 40,010,600 T732A probably damaging Het
Mdh1b A T 1: 63,718,657 I305N probably damaging Het
Mettl13 A G 1: 162,546,016 I222T probably damaging Het
Muc4 T C 16: 32,763,945 F2583L probably benign Het
Nbea C T 3: 55,717,869 R2267Q possibly damaging Het
Ndfip1 T C 18: 38,456,091 Y178H probably damaging Het
Nin A T 12: 70,056,738 F243I probably damaging Het
Nlrp10 A T 7: 108,924,662 I537K possibly damaging Het
Nup155 T C 15: 8,143,130 Y867H probably damaging Het
Pik3r4 A C 9: 105,672,706 I999L probably benign Het
Pitpnm3 G A 11: 72,061,466 probably benign Het
Pkd1l2 G A 8: 117,065,745 T436I probably benign Het
Polg2 A T 11: 106,775,440 V293E probably benign Het
Prok1 T C 3: 107,237,215 probably null Het
Ptcd1 T C 5: 145,154,690 D533G possibly damaging Het
Ptpn13 T C 5: 103,560,025 V1484A probably damaging Het
Rapgef2 A T 3: 79,092,986 probably benign Het
Serpinb8 T G 1: 107,602,856 F121L probably damaging Het
Sh3rf1 T A 8: 61,226,047 V41E probably damaging Het
Snx13 A G 12: 35,132,127 N725S possibly damaging Het
Soga1 G A 2: 157,041,934 T363I possibly damaging Het
Stab1 A T 14: 31,146,024 probably null Het
Themis A T 10: 28,761,620 probably benign Het
Trim68 T A 7: 102,678,573 Y391F probably benign Het
Trmt1 T G 8: 84,696,960 V327G probably null Het
Vill C T 9: 119,067,445 T120M probably benign Het
Other mutations in A530016L24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03406:A530016L24Rik APN 12 112496883 splice site probably null
R5678:A530016L24Rik UTSW 12 112496872 missense probably damaging 1.00
Z1177:A530016L24Rik UTSW 12 112495076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGGGCACAGGATTTATC -3'
(R):5'- CTGGAGTTCCAAGGACAGAG -3'

Sequencing Primer
(F):5'- ATCTGTGCTGTGAGCCCTACAAAG -3'
(R):5'- AGGGATCCTGTCTGTCCC -3'
Posted On 2016-06-08