Incidental Mutation 'IGL02835:Nup155'
ID391997
Institutional Source Beutler Lab
Gene Symbol Nup155
Ensembl Gene ENSMUSG00000022142
Gene Namenucleoporin 155
SynonymsD930027M19Rik
Accession Numbers

Genbank: NM_133227

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02835 (G1)
Quality Score53
Status Validated
Chromosome15
Chromosomal Location8109273-8161247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8143130 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 867 (Y867H)
Ref Sequence ENSEMBL: ENSMUSP00000155093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]
Predicted Effect probably damaging
Transcript: ENSMUST00000163765
AA Change: Y867H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: Y867H

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Nucleoporin_N 77 510 3.5e-105 PFAM
low complexity region 600 619 N/A INTRINSIC
Pfam:Nucleoporin_C 678 1221 3.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229039
Predicted Effect probably damaging
Transcript: ENSMUST00000230017
AA Change: Y867H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230337
Meta Mutation Damage Score 0.9002 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,210,655 K208* probably null Het
A530016L24Rik A C 12: 112,494,986 probably null Het
A830018L16Rik A C 1: 11,972,055 D433A possibly damaging Het
Abca13 T A 11: 9,451,515 I3985N probably damaging Het
Abhd17c C T 7: 84,151,523 D108N probably benign Het
Adam29 C T 8: 55,873,138 D94N probably damaging Het
Agr2 A G 12: 35,995,904 D50G probably benign Het
Akap2 C G 4: 57,883,044 P837A probably damaging Het
Angptl1 A G 1: 156,858,520 D392G probably benign Het
Apob A G 12: 8,015,097 N3989S possibly damaging Het
AU018091 T C 7: 3,169,071 D12G unknown Het
Cyfip2 A T 11: 46,249,771 S742T probably benign Het
Dlc1 C T 8: 36,583,901 S892N probably damaging Het
Dsg1b A G 18: 20,392,014 N169S possibly damaging Het
Egfem1 T C 3: 29,657,241 L323P probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Fjx1 G A 2: 102,450,747 A281V possibly damaging Het
Fmn2 T A 1: 174,582,059 D619E unknown Het
Gm13088 T A 4: 143,654,247 Y402F probably damaging Het
Gm4795 A C 10: 45,006,158 noncoding transcript Het
Gm5117 T C 8: 31,737,170 noncoding transcript Het
Gm5250 T C 1: 13,062,194 noncoding transcript Het
Gtdc1 A T 2: 44,756,312 Y101* probably null Het
Herc6 T C 6: 57,646,161 I583T possibly damaging Het
Hyal4 G A 6: 24,765,715 R356H probably benign Het
Il22ra2 C A 10: 19,626,676 T81K probably benign Het
Iqcm T A 8: 75,554,883 probably benign Het
Izumo4 G A 10: 80,705,125 V220I probably benign Het
Kif16b A T 2: 142,712,213 D899E probably benign Het
Lrp2 A T 2: 69,505,304 N1358K probably damaging Het
Lrrk2 A G 15: 91,814,660 probably null Het
Lyst C T 13: 13,661,100 T1789M possibly damaging Het
Map4k4 A G 1: 40,010,600 T732A probably damaging Het
Mdh1b A T 1: 63,718,657 I305N probably damaging Het
Mettl13 A G 1: 162,546,016 I222T probably damaging Het
Muc4 T C 16: 32,763,945 F2583L probably benign Het
Nbea C T 3: 55,717,869 R2267Q possibly damaging Het
Ndfip1 T C 18: 38,456,091 Y178H probably damaging Het
Nin A T 12: 70,056,738 F243I probably damaging Het
Nlrp10 A T 7: 108,924,662 I537K possibly damaging Het
Pik3r4 A C 9: 105,672,706 I999L probably benign Het
Pitpnm3 G A 11: 72,061,466 probably benign Het
Pkd1l2 G A 8: 117,065,745 T436I probably benign Het
Polg2 A T 11: 106,775,440 V293E probably benign Het
Prok1 T C 3: 107,237,215 probably null Het
Ptcd1 T C 5: 145,154,690 D533G possibly damaging Het
Ptpn13 T C 5: 103,560,025 V1484A probably damaging Het
Rapgef2 A T 3: 79,092,986 probably benign Het
Serpinb8 T G 1: 107,602,856 F121L probably damaging Het
Sh3rf1 T A 8: 61,226,047 V41E probably damaging Het
Snx13 A G 12: 35,132,127 N725S possibly damaging Het
Soga1 G A 2: 157,041,934 T363I possibly damaging Het
Stab1 A T 14: 31,146,024 probably null Het
Themis A T 10: 28,761,620 probably benign Het
Trim68 T A 7: 102,678,573 Y391F probably benign Het
Trmt1 T G 8: 84,696,960 V327G probably null Het
Vill C T 9: 119,067,445 T120M probably benign Het
Other mutations in Nup155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nup155 APN 15 8121455 splice site probably benign
IGL00426:Nup155 APN 15 8156794 makesense probably null
IGL00765:Nup155 APN 15 8153228 missense probably benign 0.16
IGL00936:Nup155 APN 15 8128405 splice site probably benign
IGL01124:Nup155 APN 15 8153679 missense probably damaging 0.97
IGL01739:Nup155 APN 15 8135788 missense probably benign 0.01
IGL02013:Nup155 APN 15 8113648 missense possibly damaging 0.61
IGL02066:Nup155 APN 15 8157766 unclassified probably benign
IGL02231:Nup155 APN 15 8144064 missense probably damaging 1.00
IGL02246:Nup155 APN 15 8143002 missense probably benign
IGL02289:Nup155 APN 15 8131493 missense probably damaging 1.00
IGL02608:Nup155 APN 15 8109471 missense probably benign
IGL02749:Nup155 APN 15 8134076 missense probably damaging 1.00
IGL02813:Nup155 APN 15 8130121 splice site probably benign
IGL03102:Nup155 APN 15 8147284 missense probably benign 0.00
H8930:Nup155 UTSW 15 8157658 missense possibly damaging 0.50
R0314:Nup155 UTSW 15 8147252 missense probably benign 0.00
R0365:Nup155 UTSW 15 8131543 missense probably damaging 1.00
R0586:Nup155 UTSW 15 8130232 missense probably benign 0.39
R0764:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R0839:Nup155 UTSW 15 8145587 missense possibly damaging 0.48
R0844:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1066:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1067:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1085:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1137:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1162:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1166:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1202:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1203:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1219:Nup155 UTSW 15 8117338 missense possibly damaging 0.80
R1385:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1421:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1448:Nup155 UTSW 15 8112406 missense probably benign 0.44
R1611:Nup155 UTSW 15 8130160 missense probably damaging 1.00
R1836:Nup155 UTSW 15 8154980 missense possibly damaging 0.79
R1863:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1866:Nup155 UTSW 15 8115526 missense probably damaging 1.00
R1894:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1976:Nup155 UTSW 15 8135827 missense probably benign 0.01
R2024:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2026:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2027:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2077:Nup155 UTSW 15 8143026 missense probably damaging 1.00
R2111:Nup155 UTSW 15 8121467 missense probably benign 0.45
R2921:Nup155 UTSW 15 8153641 missense probably damaging 1.00
R2936:Nup155 UTSW 15 8143049 missense possibly damaging 0.89
R3108:Nup155 UTSW 15 8117306 missense probably null 1.00
R3161:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3522:Nup155 UTSW 15 8156678 splice site probably benign
R4423:Nup155 UTSW 15 8121464 missense probably damaging 0.99
R4451:Nup155 UTSW 15 8150882 missense probably benign 0.02
R4498:Nup155 UTSW 15 8153673 missense possibly damaging 0.88
R4780:Nup155 UTSW 15 8157703 missense probably benign 0.00
R4822:Nup155 UTSW 15 8128526 missense possibly damaging 0.49
R5013:Nup155 UTSW 15 8124238 missense probably benign 0.00
R5064:Nup155 UTSW 15 8135870 missense probably damaging 1.00
R5172:Nup155 UTSW 15 8109542 missense probably benign 0.06
R5406:Nup155 UTSW 15 8153638 critical splice acceptor site probably null
R5551:Nup155 UTSW 15 8148333 missense probably benign 0.09
R5588:Nup155 UTSW 15 8119253 critical splice donor site probably null
R5977:Nup155 UTSW 15 8130237 critical splice donor site probably null
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6085:Nup155 UTSW 15 8148358 missense probably damaging 0.98
R6188:Nup155 UTSW 15 8109575 missense probably damaging 1.00
R6232:Nup155 UTSW 15 8109479 missense probably benign 0.02
R6257:Nup155 UTSW 15 8150798 nonsense probably null
R6262:Nup155 UTSW 15 8156741 missense probably benign 0.03
R6267:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6296:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6299:Nup155 UTSW 15 8128438 missense possibly damaging 0.88
R6303:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6304:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6763:Nup155 UTSW 15 8135895 nonsense probably null
R6958:Nup155 UTSW 15 8147154 missense probably damaging 1.00
R7088:Nup155 UTSW 15 8156693 missense probably benign 0.11
R7313:Nup155 UTSW 15 8154922 missense probably damaging 0.96
R7451:Nup155 UTSW 15 8145607 nonsense probably null
R7560:Nup155 UTSW 15 8155047 missense probably benign 0.39
R7633:Nup155 UTSW 15 8109453 missense probably damaging 0.99
R7670:Nup155 UTSW 15 8153696 missense probably damaging 0.99
R7726:Nup155 UTSW 15 8122139 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTTCCTAGGAATTTCAAGAG -3'
(R):5'- GCCGAAGATACTGTATATGTAACAC -3'

Sequencing Primer
(F):5'- CTTCCTAGGAATTTCAAGAGCAGCTG -3'
(R):5'- GGGAAAACCCTGATTCTC -3'
Posted On2016-06-08