Incidental Mutation 'IGL02835:Lrrk2'
ID 391998
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 4921513O20Rik, cI-46, D630001M17Rik, 9330188B09Rik, LOC381026
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # IGL02835 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 91557378-91700323 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 91698863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably null
Transcript: ENSMUST00000060642
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172797
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,937,284 (GRCm39) K208* probably null Het
A530016L24Rik A C 12: 112,461,420 (GRCm39) probably null Het
A830018L16Rik A C 1: 12,042,279 (GRCm39) D433A possibly damaging Het
Abca13 T A 11: 9,401,515 (GRCm39) I3985N probably damaging Het
Abhd17c C T 7: 83,800,731 (GRCm39) D108N probably benign Het
Adam29 C T 8: 56,326,173 (GRCm39) D94N probably damaging Het
Agr2 A G 12: 36,045,903 (GRCm39) D50G probably benign Het
Angptl1 A G 1: 156,686,090 (GRCm39) D392G probably benign Het
Apob A G 12: 8,065,097 (GRCm39) N3989S possibly damaging Het
AU018091 T C 7: 3,218,897 (GRCm39) D12G unknown Het
Cyfip2 A T 11: 46,140,598 (GRCm39) S742T probably benign Het
Dlc1 C T 8: 37,051,055 (GRCm39) S892N probably damaging Het
Dsg1b A G 18: 20,525,071 (GRCm39) N169S possibly damaging Het
Egfem1 T C 3: 29,711,390 (GRCm39) L323P probably damaging Het
Emilin3 G A 2: 160,750,649 (GRCm39) Q320* probably null Het
Fjx1 G A 2: 102,281,092 (GRCm39) A281V possibly damaging Het
Fmn2 T A 1: 174,409,625 (GRCm39) D619E unknown Het
Gm4795 A C 10: 44,882,254 (GRCm39) noncoding transcript Het
Gm5117 T C 8: 32,227,198 (GRCm39) noncoding transcript Het
Gm5250 T C 1: 13,132,418 (GRCm39) noncoding transcript Het
Gtdc1 A T 2: 44,646,324 (GRCm39) Y101* probably null Het
Herc6 T C 6: 57,623,146 (GRCm39) I583T possibly damaging Het
Hyal4 G A 6: 24,765,714 (GRCm39) R356H probably benign Het
Il22ra2 C A 10: 19,502,424 (GRCm39) T81K probably benign Het
Iqcm T A 8: 76,281,511 (GRCm39) probably benign Het
Izumo4 G A 10: 80,540,959 (GRCm39) V220I probably benign Het
Kif16b A T 2: 142,554,133 (GRCm39) D899E probably benign Het
Lrp2 A T 2: 69,335,648 (GRCm39) N1358K probably damaging Het
Lyst C T 13: 13,835,685 (GRCm39) T1789M possibly damaging Het
Map4k4 A G 1: 40,049,760 (GRCm39) T732A probably damaging Het
Mdh1b A T 1: 63,757,816 (GRCm39) I305N probably damaging Het
Mettl13 A G 1: 162,373,585 (GRCm39) I222T probably damaging Het
Mtcl2 G A 2: 156,883,854 (GRCm39) T363I possibly damaging Het
Muc4 T C 16: 32,584,319 (GRCm39) F2583L probably benign Het
Nbea C T 3: 55,625,290 (GRCm39) R2267Q possibly damaging Het
Ndfip1 T C 18: 38,589,144 (GRCm39) Y178H probably damaging Het
Nin A T 12: 70,103,512 (GRCm39) F243I probably damaging Het
Nlrp10 A T 7: 108,523,869 (GRCm39) I537K possibly damaging Het
Nup155 T C 15: 8,172,614 (GRCm39) Y867H probably damaging Het
Pakap C G 4: 57,883,044 (GRCm39) P837A probably damaging Het
Pik3r4 A C 9: 105,549,905 (GRCm39) I999L probably benign Het
Pitpnm3 G A 11: 71,952,292 (GRCm39) probably benign Het
Pkd1l2 G A 8: 117,792,484 (GRCm39) T436I probably benign Het
Polg2 A T 11: 106,666,266 (GRCm39) V293E probably benign Het
Pramel22 T A 4: 143,380,817 (GRCm39) Y402F probably damaging Het
Prok1 T C 3: 107,144,531 (GRCm39) probably null Het
Ptcd1 T C 5: 145,091,500 (GRCm39) D533G possibly damaging Het
Ptpn13 T C 5: 103,707,891 (GRCm39) V1484A probably damaging Het
Rapgef2 A T 3: 79,000,293 (GRCm39) probably benign Het
Serpinb8 T G 1: 107,530,586 (GRCm39) F121L probably damaging Het
Sh3rf1 T A 8: 61,679,081 (GRCm39) V41E probably damaging Het
Snx13 A G 12: 35,182,126 (GRCm39) N725S possibly damaging Het
Stab1 A T 14: 30,867,981 (GRCm39) probably null Het
Themis A T 10: 28,637,616 (GRCm39) probably benign Het
Trim68 T A 7: 102,327,780 (GRCm39) Y391F probably benign Het
Trmt1 T G 8: 85,423,589 (GRCm39) V327G probably null Het
Vill C T 9: 118,896,513 (GRCm39) T120M probably benign Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91,632,002 (GRCm39) missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91,584,146 (GRCm39) missense probably benign
IGL00770:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00774:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00791:Lrrk2 APN 15 91,664,044 (GRCm39) missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91,639,993 (GRCm39) missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91,641,261 (GRCm39) missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91,623,035 (GRCm39) missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91,610,340 (GRCm39) missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91,567,345 (GRCm39) missense probably benign
IGL01301:Lrrk2 APN 15 91,651,542 (GRCm39) missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91,584,772 (GRCm39) splice site probably null
IGL01465:Lrrk2 APN 15 91,613,128 (GRCm39) missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91,696,516 (GRCm39) missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91,584,192 (GRCm39) missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91,659,191 (GRCm39) missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91,664,149 (GRCm39) missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91,615,694 (GRCm39) missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91,610,511 (GRCm39) critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91,570,025 (GRCm39) missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91,634,480 (GRCm39) missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91,631,958 (GRCm39) missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91,584,781 (GRCm39) missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91,681,617 (GRCm39) splice site probably null
horned UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
spree UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
Spur UTSW 15 91,659,198 (GRCm39) nonsense probably null
3-1:Lrrk2 UTSW 15 91,686,137 (GRCm39) missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91,651,542 (GRCm39) missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
H8786:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0078:Lrrk2 UTSW 15 91,618,212 (GRCm39) missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91,629,999 (GRCm39) missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91,662,617 (GRCm39) splice site probably benign
R0448:Lrrk2 UTSW 15 91,593,508 (GRCm39) missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91,634,478 (GRCm39) missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91,699,619 (GRCm39) missense probably benign
R0617:Lrrk2 UTSW 15 91,636,481 (GRCm39) missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91,680,231 (GRCm39) missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91,657,199 (GRCm39) missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91,641,273 (GRCm39) critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91,659,249 (GRCm39) splice site probably null
R0766:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91,640,165 (GRCm39) missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91,613,284 (GRCm39) missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91,613,372 (GRCm39) missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91,557,892 (GRCm39) missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91,584,671 (GRCm39) nonsense probably null
R1223:Lrrk2 UTSW 15 91,557,838 (GRCm39) missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91,696,563 (GRCm39) missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91,613,123 (GRCm39) missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91,618,261 (GRCm39) missense probably benign
R1773:Lrrk2 UTSW 15 91,664,184 (GRCm39) missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91,584,095 (GRCm39) missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91,567,337 (GRCm39) missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91,620,864 (GRCm39) splice site probably null
R2160:Lrrk2 UTSW 15 91,680,263 (GRCm39) missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91,648,919 (GRCm39) missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91,681,729 (GRCm39) splice site probably benign
R2516:Lrrk2 UTSW 15 91,640,130 (GRCm39) missense probably benign
R3110:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91,621,314 (GRCm39) missense probably benign
R3842:Lrrk2 UTSW 15 91,640,119 (GRCm39) missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91,631,904 (GRCm39) missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91,631,903 (GRCm39) missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91,651,664 (GRCm39) critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,596,983 (GRCm39) missense possibly damaging 0.69
R3982:Lrrk2 UTSW 15 91,593,487 (GRCm39) missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91,699,686 (GRCm39) missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91,639,997 (GRCm39) missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91,632,023 (GRCm39) missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91,607,391 (GRCm39) missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91,589,323 (GRCm39) missense probably benign
R4539:Lrrk2 UTSW 15 91,613,345 (GRCm39) missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91,573,104 (GRCm39) missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91,648,962 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91,597,031 (GRCm39) missense probably benign
R4945:Lrrk2 UTSW 15 91,689,123 (GRCm39) missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91,687,592 (GRCm39) missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91,634,081 (GRCm39) missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91,584,822 (GRCm39) missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91,649,993 (GRCm39) missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91,698,847 (GRCm39) splice site probably null
R5551:Lrrk2 UTSW 15 91,696,553 (GRCm39) missense probably benign
R5574:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91,649,948 (GRCm39) missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91,687,504 (GRCm39) nonsense probably null
R5712:Lrrk2 UTSW 15 91,586,425 (GRCm39) nonsense probably null
R5728:Lrrk2 UTSW 15 91,659,177 (GRCm39) missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91,586,386 (GRCm39) missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91,648,851 (GRCm39) missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91,593,593 (GRCm39) critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91,640,152 (GRCm39) missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91,618,249 (GRCm39) missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91,630,034 (GRCm39) missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91,657,148 (GRCm39) missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91,607,338 (GRCm39) missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91,632,029 (GRCm39) missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91,626,469 (GRCm39) missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91,607,421 (GRCm39) missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91,659,198 (GRCm39) nonsense probably null
R7072:Lrrk2 UTSW 15 91,686,123 (GRCm39) missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91,648,985 (GRCm39) missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91,686,088 (GRCm39) missense probably benign
R7144:Lrrk2 UTSW 15 91,618,258 (GRCm39) missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91,641,204 (GRCm39) missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91,584,644 (GRCm39) missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91,622,947 (GRCm39) missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91,615,858 (GRCm39) critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91,584,207 (GRCm39) critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91,651,543 (GRCm39) missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91,696,528 (GRCm39) missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91,696,526 (GRCm39) missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91,584,561 (GRCm39) missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91,610,389 (GRCm39) missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91,699,649 (GRCm39) missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91,584,816 (GRCm39) missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91,651,527 (GRCm39) missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91,610,355 (GRCm39) missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91,557,443 (GRCm39) start gained probably benign
R8389:Lrrk2 UTSW 15 91,584,194 (GRCm39) missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91,615,680 (GRCm39) missense probably benign
R8698:Lrrk2 UTSW 15 91,636,400 (GRCm39) missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91,586,473 (GRCm39) nonsense probably null
R9084:Lrrk2 UTSW 15 91,634,469 (GRCm39) missense
R9086:Lrrk2 UTSW 15 91,640,051 (GRCm39) missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9097:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9267:Lrrk2 UTSW 15 91,584,629 (GRCm39) missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91,662,686 (GRCm39) missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91,607,407 (GRCm39) missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9489:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91,607,365 (GRCm39) missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91,634,043 (GRCm39) missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9605:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91,696,527 (GRCm39) missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91,671,251 (GRCm39) missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91,634,482 (GRCm39) nonsense probably null
R9728:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91,695,229 (GRCm39) missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91,620,836 (GRCm39) missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91,623,054 (GRCm39) missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91,610,443 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTGTGCCCTAAAGAGTAGCAG -3'
(R):5'- CTGAGTGTCGAGTGCGTTAC -3'

Sequencing Primer
(F):5'- TCTCAGCAGTTAAGAGCACTGACTG -3'
(R):5'- TGCGTTACACAAGCCATCAG -3'
Posted On 2016-06-08