Incidental Mutation 'IGL02796:Flg2'
ID392012
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #IGL02796 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93203613 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 983 (R983W)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: R983W
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: R983W

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A T 19: 55,278,169 K86* probably null Het
Ambp C A 4: 63,153,932 probably benign Het
Atp6v0d2 A T 4: 19,887,324 M208K probably damaging Het
Brinp1 C G 4: 68,762,190 R701P probably damaging Het
Btnl9 T C 11: 49,169,181 D580G probably damaging Het
Cand1 A T 10: 119,213,638 L401H probably damaging Het
Ccdc66 T C 14: 27,486,566 E577G possibly damaging Het
Ccdc93 C A 1: 121,491,166 D483E probably damaging Het
Cd38 T C 5: 43,906,213 L216P probably damaging Het
Cdr1 C T X: 61,184,481 D360N possibly damaging Het
Col9a3 G T 2: 180,614,162 D443Y probably damaging Het
Cpt1b C T 15: 89,424,802 V66I probably benign Het
Cyp8b1 T A 9: 121,915,498 Y256F probably benign Het
Dync1i1 A G 6: 5,757,385 N48S probably benign Het
Ehd3 T A 17: 73,816,401 L133Q probably damaging Het
Eif6 C A 2: 155,826,148 R57L probably damaging Het
Fam45a A G 19: 60,817,643 probably benign Het
Fam92b C T 8: 120,177,399 probably benign Het
Fcgbp T A 7: 28,101,151 probably benign Het
Fgl1 C T 8: 41,197,058 A229T probably benign Het
Gdf7 A T 12: 8,301,666 S90T unknown Het
Ggta1 T C 2: 35,413,317 probably benign Het
Gm44859 C T 19: 12,036,748 probably benign Het
Grin2a T C 16: 9,585,108 E838G possibly damaging Het
Grin2c A G 11: 115,250,717 probably benign Het
Grm1 T C 10: 10,689,667 T966A probably benign Het
Gtpbp1 A G 15: 79,716,985 I468M possibly damaging Het
Gucy1b2 G A 14: 62,407,694 P639S probably benign Het
Hat1 T C 2: 71,420,356 probably null Het
Hira A T 16: 18,925,654 I374F probably benign Het
Htt C A 5: 34,877,482 Q2024K probably benign Het
Kcnj6 A G 16: 94,832,919 M111T probably benign Het
Loxhd1 T A 18: 77,369,115 probably benign Het
Lrif1 T A 3: 106,735,436 M619K probably benign Het
Lrrc8b G A 5: 105,481,345 G519D probably damaging Het
Map3k7 A G 4: 31,979,692 probably benign Het
Olfr1018 T C 2: 85,823,589 I206T probably benign Het
Olfr1428 T A 19: 12,108,884 I221F possibly damaging Het
P2ry12 T C 3: 59,217,881 I124M probably damaging Het
Paxbp1 A G 16: 91,025,294 probably benign Het
Polb A T 8: 22,631,458 I257N probably damaging Het
Psg27 A T 7: 18,561,950 V190E probably benign Het
Rabgap1 T A 2: 37,472,306 N54K probably damaging Het
Sacm1l T A 9: 123,548,924 W90R possibly damaging Het
Snrpb2 A T 2: 143,064,567 M1L probably benign Het
Spata31d1d A G 13: 59,728,243 Y493H possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Spocd1 A G 4: 129,947,755 probably benign Het
Tbc1d5 G T 17: 50,966,624 H123Q probably damaging Het
Ttn T C 2: 76,778,101 N17826S probably damaging Het
Tubgcp6 A G 15: 89,122,390 I143T probably benign Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Zfhx4 G A 3: 5,399,539 V1586M probably damaging Het
Zfp146 C T 7: 30,162,558 V20I probably benign Het
Zfp263 G A 16: 3,746,876 E252K probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCAACATAGACATCCG -3'
(R):5'- ATGTCTTGCCTGACCCTGAC -3'

Sequencing Primer
(F):5'- TGGCCAACATAGACATCCGCTATC -3'
(R):5'- ACTGTGACAGTGACTGGATCC -3'
Posted On2016-06-08