Incidental Mutation 'IGL02796:Fcgbp'
ID 392024
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene Name Fc fragment of IgG binding protein
Synonyms A430096B05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # IGL02796 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 28071236-28120862 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 28101151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
AlphaFold E9Q0B5
Predicted Effect probably benign
Transcript: ENSMUST00000076648
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000098634
AA Change: M133L
Predicted Effect probably benign
Transcript: ENSMUST00000138392
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148946
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A T 19: 55,278,169 K86* probably null Het
Ambp C A 4: 63,153,932 probably benign Het
Atp6v0d2 A T 4: 19,887,324 M208K probably damaging Het
Brinp1 C G 4: 68,762,190 R701P probably damaging Het
Btnl9 T C 11: 49,169,181 D580G probably damaging Het
Cand1 A T 10: 119,213,638 L401H probably damaging Het
Ccdc66 T C 14: 27,486,566 E577G possibly damaging Het
Ccdc93 C A 1: 121,491,166 D483E probably damaging Het
Cd38 T C 5: 43,906,213 L216P probably damaging Het
Cdr1 C T X: 61,184,481 D360N possibly damaging Het
Col9a3 G T 2: 180,614,162 D443Y probably damaging Het
Cpt1b C T 15: 89,424,802 V66I probably benign Het
Cyp8b1 T A 9: 121,915,498 Y256F probably benign Het
Dync1i1 A G 6: 5,757,385 N48S probably benign Het
Ehd3 T A 17: 73,816,401 L133Q probably damaging Het
Eif6 C A 2: 155,826,148 R57L probably damaging Het
Fam45a A G 19: 60,817,643 probably benign Het
Fam92b C T 8: 120,177,399 probably benign Het
Fgl1 C T 8: 41,197,058 A229T probably benign Het
Flg2 C T 3: 93,203,613 R983W unknown Het
Gdf7 A T 12: 8,301,666 S90T unknown Het
Ggta1 T C 2: 35,413,317 probably benign Het
Gm44859 C T 19: 12,036,748 probably benign Het
Grin2a T C 16: 9,585,108 E838G possibly damaging Het
Grin2c A G 11: 115,250,717 probably benign Het
Grm1 T C 10: 10,689,667 T966A probably benign Het
Gtpbp1 A G 15: 79,716,985 I468M possibly damaging Het
Gucy1b2 G A 14: 62,407,694 P639S probably benign Het
Hat1 T C 2: 71,420,356 probably null Het
Hira A T 16: 18,925,654 I374F probably benign Het
Htt C A 5: 34,877,482 Q2024K probably benign Het
Kcnj6 A G 16: 94,832,919 M111T probably benign Het
Loxhd1 T A 18: 77,369,115 probably benign Het
Lrif1 T A 3: 106,735,436 M619K probably benign Het
Lrrc8b G A 5: 105,481,345 G519D probably damaging Het
Map3k7 A G 4: 31,979,692 probably benign Het
Olfr1018 T C 2: 85,823,589 I206T probably benign Het
Olfr1428 T A 19: 12,108,884 I221F possibly damaging Het
P2ry12 T C 3: 59,217,881 I124M probably damaging Het
Paxbp1 A G 16: 91,025,294 probably benign Het
Polb A T 8: 22,631,458 I257N probably damaging Het
Psg27 A T 7: 18,561,950 V190E probably benign Het
Rabgap1 T A 2: 37,472,306 N54K probably damaging Het
Sacm1l T A 9: 123,548,924 W90R possibly damaging Het
Snrpb2 A T 2: 143,064,567 M1L probably benign Het
Spata31d1d A G 13: 59,728,243 Y493H possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Spocd1 A G 4: 129,947,755 probably benign Het
Tbc1d5 G T 17: 50,966,624 H123Q probably damaging Het
Ttn T C 2: 76,778,101 N17826S probably damaging Het
Tubgcp6 A G 15: 89,122,390 I143T probably benign Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Zfhx4 G A 3: 5,399,539 V1586M probably damaging Het
Zfp146 C T 7: 30,162,558 V20I probably benign Het
Zfp263 G A 16: 3,746,876 E252K probably benign Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
bilge UTSW 7 28117337 missense probably benign 0.00
R6548_fcgbp_365 UTSW 7 28091918 missense probably benign 0.00
swill UTSW 7 28089734 missense probably damaging 1.00
G1citation:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
R7831:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7835:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
R7947:Fcgbp UTSW 7 28104170 critical splice donor site probably null
R8086:Fcgbp UTSW 7 28113964 missense probably damaging 1.00
R8137:Fcgbp UTSW 7 28105071 missense probably damaging 1.00
R8154:Fcgbp UTSW 7 28085082 missense probably benign 0.00
R8169:Fcgbp UTSW 7 28085494 critical splice donor site probably null
R8176:Fcgbp UTSW 7 28091749 missense possibly damaging 0.88
R8193:Fcgbp UTSW 7 28104851 missense probably damaging 1.00
R8313:Fcgbp UTSW 7 28086344 missense probably benign 0.00
R8350:Fcgbp UTSW 7 28094189 missense probably benign 0.02
R8382:Fcgbp UTSW 7 28117337 missense probably benign 0.00
R8393:Fcgbp UTSW 7 28107390 missense probably benign 0.18
R8438:Fcgbp UTSW 7 28089806 missense probably benign 0.25
R8489:Fcgbp UTSW 7 28105010 missense possibly damaging 0.94
R8495:Fcgbp UTSW 7 28086553 missense probably damaging 1.00
R8707:Fcgbp UTSW 7 28120495 missense probably benign 0.01
R8736:Fcgbp UTSW 7 28106196 missense probably benign 0.05
R8816:Fcgbp UTSW 7 28084987 missense probably benign 0.09
R8905:Fcgbp UTSW 7 28086509 missense probably damaging 1.00
R9031:Fcgbp UTSW 7 28091483 missense possibly damaging 0.89
R9063:Fcgbp UTSW 7 28091852 missense probably damaging 1.00
R9180:Fcgbp UTSW 7 28103773 nonsense probably null
R9262:Fcgbp UTSW 7 28120527 missense probably damaging 1.00
R9439:Fcgbp UTSW 7 28104011 missense possibly damaging 0.60
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Z1186:Fcgbp UTSW 7 28086191 missense probably benign
Z1186:Fcgbp UTSW 7 28089755 missense probably benign
Z1186:Fcgbp UTSW 7 28091647 missense probably benign
Z1186:Fcgbp UTSW 7 28093345 missense probably benign
Z1186:Fcgbp UTSW 7 28103884 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCAAACTGAGAGATTTAGACGCGG -3'
(R):5'- TGCCCTGGAAGTCAAAGCTC -3'

Sequencing Primer
(F):5'- GGGACCCTAGACATGAGATACG -3'
(R):5'- CTCCAGCCATCGAAGGAGTTGTAG -3'
Posted On 2016-06-08