Incidental Mutation 'IGL02796:Fam92b'
ID392028
Institutional Source Beutler Lab
Gene Symbol Fam92b
Ensembl Gene ENSMUSG00000042269
Gene Namefamily with sequence similarity 92, member B
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #IGL02796 (G1)
Quality Score140
Status Validated
Chromosome8
Chromosomal Location120166397-120177466 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) C to T at 120177399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048786] [ENSMUST00000127664] [ENSMUST00000135567]
Predicted Effect probably benign
Transcript: ENSMUST00000048786
SMART Domains Protein: ENSMUSP00000038825
Gene: ENSMUSG00000042269

DomainStartEndE-ValueType
Pfam:FAM92 1 217 4.8e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135567
SMART Domains Protein: ENSMUSP00000134033
Gene: ENSMUSG00000042269

DomainStartEndE-ValueType
Pfam:FAM92 1 95 2e-21 PFAM
low complexity region 98 108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153177
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A T 19: 55,278,169 K86* probably null Het
Ambp C A 4: 63,153,932 probably benign Het
Atp6v0d2 A T 4: 19,887,324 M208K probably damaging Het
Brinp1 C G 4: 68,762,190 R701P probably damaging Het
Btnl9 T C 11: 49,169,181 D580G probably damaging Het
Cand1 A T 10: 119,213,638 L401H probably damaging Het
Ccdc66 T C 14: 27,486,566 E577G possibly damaging Het
Ccdc93 C A 1: 121,491,166 D483E probably damaging Het
Cd38 T C 5: 43,906,213 L216P probably damaging Het
Cdr1 C T X: 61,184,481 D360N possibly damaging Het
Col9a3 G T 2: 180,614,162 D443Y probably damaging Het
Cpt1b C T 15: 89,424,802 V66I probably benign Het
Cyp8b1 T A 9: 121,915,498 Y256F probably benign Het
Dync1i1 A G 6: 5,757,385 N48S probably benign Het
Ehd3 T A 17: 73,816,401 L133Q probably damaging Het
Eif6 C A 2: 155,826,148 R57L probably damaging Het
Fam45a A G 19: 60,817,643 probably benign Het
Fcgbp T A 7: 28,101,151 probably benign Het
Fgl1 C T 8: 41,197,058 A229T probably benign Het
Flg2 C T 3: 93,203,613 R983W unknown Het
Gdf7 A T 12: 8,301,666 S90T unknown Het
Ggta1 T C 2: 35,413,317 probably benign Het
Gm44859 C T 19: 12,036,748 probably benign Het
Grin2a T C 16: 9,585,108 E838G possibly damaging Het
Grin2c A G 11: 115,250,717 probably benign Het
Grm1 T C 10: 10,689,667 T966A probably benign Het
Gtpbp1 A G 15: 79,716,985 I468M possibly damaging Het
Gucy1b2 G A 14: 62,407,694 P639S probably benign Het
Hat1 T C 2: 71,420,356 probably null Het
Hira A T 16: 18,925,654 I374F probably benign Het
Htt C A 5: 34,877,482 Q2024K probably benign Het
Kcnj6 A G 16: 94,832,919 M111T probably benign Het
Loxhd1 T A 18: 77,369,115 probably benign Het
Lrif1 T A 3: 106,735,436 M619K probably benign Het
Lrrc8b G A 5: 105,481,345 G519D probably damaging Het
Map3k7 A G 4: 31,979,692 probably benign Het
Olfr1018 T C 2: 85,823,589 I206T probably benign Het
Olfr1428 T A 19: 12,108,884 I221F possibly damaging Het
P2ry12 T C 3: 59,217,881 I124M probably damaging Het
Paxbp1 A G 16: 91,025,294 probably benign Het
Polb A T 8: 22,631,458 I257N probably damaging Het
Psg27 A T 7: 18,561,950 V190E probably benign Het
Rabgap1 T A 2: 37,472,306 N54K probably damaging Het
Sacm1l T A 9: 123,548,924 W90R possibly damaging Het
Snrpb2 A T 2: 143,064,567 M1L probably benign Het
Spata31d1d A G 13: 59,728,243 Y493H possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Spocd1 A G 4: 129,947,755 probably benign Het
Tbc1d5 G T 17: 50,966,624 H123Q probably damaging Het
Ttn T C 2: 76,778,101 N17826S probably damaging Het
Tubgcp6 A G 15: 89,122,390 I143T probably benign Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Zfhx4 G A 3: 5,399,539 V1586M probably damaging Het
Zfp146 C T 7: 30,162,558 V20I probably benign Het
Zfp263 G A 16: 3,746,876 E252K probably benign Het
Other mutations in Fam92b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Fam92b APN 8 120166690 missense probably benign 0.00
IGL02045:Fam92b APN 8 120169722 nonsense probably null
IGL02437:Fam92b APN 8 120174786 missense probably damaging 1.00
R1061:Fam92b UTSW 8 120169704 critical splice donor site probably null
R2285:Fam92b UTSW 8 120168537 missense probably benign 0.01
R3714:Fam92b UTSW 8 120174837 missense probably damaging 1.00
R3831:Fam92b UTSW 8 120174894 missense probably damaging 1.00
R4432:Fam92b UTSW 8 120174855 missense probably damaging 1.00
R5431:Fam92b UTSW 8 120167303 critical splice donor site probably null
R6280:Fam92b UTSW 8 120172119 missense possibly damaging 0.75
R7026:Fam92b UTSW 8 120168585 missense probably damaging 1.00
R7233:Fam92b UTSW 8 120171922 missense probably damaging 1.00
R7278:Fam92b UTSW 8 120168603 missense possibly damaging 0.63
R7334:Fam92b UTSW 8 120174850 missense probably damaging 0.99
R7840:Fam92b UTSW 8 120166633 missense probably benign 0.32
R7923:Fam92b UTSW 8 120166633 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CTCCCTCCACTTTGAGAAGG -3'
(R):5'- ATTTCAGAGAGTGGTTAAGCCCC -3'

Sequencing Primer
(F):5'- CCTCCACTTTGAGAAGGGATGG -3'
(R):5'- CCCCAAGGCAAAGCTGG -3'
Posted On2016-06-08