Incidental Mutation 'IGL02796:Tubgcp6'
ID392040
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Nametubulin, gamma complex associated protein 6
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #IGL02796 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89098357-89123112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89122390 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 143 (I143T)
Ref Sequence ENSEMBL: ENSMUSP00000040132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082197] [ENSMUST00000109347] [ENSMUST00000109353]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
AA Change: I143T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: I143T

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082197
SMART Domains Protein: ENSMUSP00000080832
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 322 2.1e-85 PFAM
low complexity region 478 489 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109347
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109353
AA Change: I143T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: I143T

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231098
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A T 19: 55,278,169 K86* probably null Het
Ambp C A 4: 63,153,932 probably benign Het
Atp6v0d2 A T 4: 19,887,324 M208K probably damaging Het
Brinp1 C G 4: 68,762,190 R701P probably damaging Het
Btnl9 T C 11: 49,169,181 D580G probably damaging Het
Cand1 A T 10: 119,213,638 L401H probably damaging Het
Ccdc66 T C 14: 27,486,566 E577G possibly damaging Het
Ccdc93 C A 1: 121,491,166 D483E probably damaging Het
Cd38 T C 5: 43,906,213 L216P probably damaging Het
Cdr1 C T X: 61,184,481 D360N possibly damaging Het
Col9a3 G T 2: 180,614,162 D443Y probably damaging Het
Cpt1b C T 15: 89,424,802 V66I probably benign Het
Cyp8b1 T A 9: 121,915,498 Y256F probably benign Het
Dync1i1 A G 6: 5,757,385 N48S probably benign Het
Ehd3 T A 17: 73,816,401 L133Q probably damaging Het
Eif6 C A 2: 155,826,148 R57L probably damaging Het
Fam45a A G 19: 60,817,643 probably benign Het
Fam92b C T 8: 120,177,399 probably benign Het
Fcgbp T A 7: 28,101,151 probably benign Het
Fgl1 C T 8: 41,197,058 A229T probably benign Het
Flg2 C T 3: 93,203,613 R983W unknown Het
Gdf7 A T 12: 8,301,666 S90T unknown Het
Ggta1 T C 2: 35,413,317 probably benign Het
Gm44859 C T 19: 12,036,748 probably benign Het
Grin2a T C 16: 9,585,108 E838G possibly damaging Het
Grin2c A G 11: 115,250,717 probably benign Het
Grm1 T C 10: 10,689,667 T966A probably benign Het
Gtpbp1 A G 15: 79,716,985 I468M possibly damaging Het
Gucy1b2 G A 14: 62,407,694 P639S probably benign Het
Hat1 T C 2: 71,420,356 probably null Het
Hira A T 16: 18,925,654 I374F probably benign Het
Htt C A 5: 34,877,482 Q2024K probably benign Het
Kcnj6 A G 16: 94,832,919 M111T probably benign Het
Loxhd1 T A 18: 77,369,115 probably benign Het
Lrif1 T A 3: 106,735,436 M619K probably benign Het
Lrrc8b G A 5: 105,481,345 G519D probably damaging Het
Map3k7 A G 4: 31,979,692 probably benign Het
Olfr1018 T C 2: 85,823,589 I206T probably benign Het
Olfr1428 T A 19: 12,108,884 I221F possibly damaging Het
P2ry12 T C 3: 59,217,881 I124M probably damaging Het
Paxbp1 A G 16: 91,025,294 probably benign Het
Polb A T 8: 22,631,458 I257N probably damaging Het
Psg27 A T 7: 18,561,950 V190E probably benign Het
Rabgap1 T A 2: 37,472,306 N54K probably damaging Het
Sacm1l T A 9: 123,548,924 W90R possibly damaging Het
Snrpb2 A T 2: 143,064,567 M1L probably benign Het
Spata31d1d A G 13: 59,728,243 Y493H possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Spocd1 A G 4: 129,947,755 probably benign Het
Tbc1d5 G T 17: 50,966,624 H123Q probably damaging Het
Ttn T C 2: 76,778,101 N17826S probably damaging Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Zfhx4 G A 3: 5,399,539 V1586M probably damaging Het
Zfp146 C T 7: 30,162,558 V20I probably benign Het
Zfp263 G A 16: 3,746,876 E252K probably benign Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 89104008 missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 89100962 missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89122397 nonsense probably null
IGL01284:Tubgcp6 APN 15 89110055 missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 89107525 missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 89107996 nonsense probably null
IGL01792:Tubgcp6 APN 15 89101281 missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 89103488 missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 89100914 missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 89102315 nonsense probably null
IGL02873:Tubgcp6 APN 15 89103824 missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 89108099 unclassified probably benign
R0010:Tubgcp6 UTSW 15 89103183 missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89122436 missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 89103065 missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 89100987 missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 89107442 missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 89100608 missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 89104166 missense probably benign 0.01
R2067:Tubgcp6 UTSW 15 89104489 missense probably benign 0.03
R2083:Tubgcp6 UTSW 15 89122376 missense probably damaging 1.00
R2285:Tubgcp6 UTSW 15 89122474 missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 89102984 missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 89102365 missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 89103082 nonsense probably null
R3054:Tubgcp6 UTSW 15 89122603 missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 89104414 unclassified probably benign
R4350:Tubgcp6 UTSW 15 89103995 missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 89103654 missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 89103818 missense probably benign
R4937:Tubgcp6 UTSW 15 89101549 missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 89106291 missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 89103490 missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 89099545 unclassified probably benign
R5122:Tubgcp6 UTSW 15 89116103 missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 89108612 missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 89103247 missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 89109217 splice site probably null
R6111:Tubgcp6 UTSW 15 89100920 missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89122791 missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89122877 start gained probably benign
R7074:Tubgcp6 UTSW 15 89120636 missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 89101029 missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 89102970 nonsense probably null
R7275:Tubgcp6 UTSW 15 89102943 nonsense probably null
R7514:Tubgcp6 UTSW 15 89120525 missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 89102323 missense possibly damaging 0.48
R7571:Tubgcp6 UTSW 15 89100722 missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 89104223 missense probably benign
R7721:Tubgcp6 UTSW 15 89101401 missense probably damaging 1.00
R7996:Tubgcp6 UTSW 15 89109028 missense possibly damaging 0.92
R8095:Tubgcp6 UTSW 15 89122774 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTCACCAATTGAGAAGAGCC -3'
(R):5'- AACAAGGTCCTCATGCTGTCC -3'

Sequencing Primer
(F):5'- CCAATTGAGAAGAGCCCAACGG -3'
(R):5'- CATGCTGTCCTTCGATTTGAG -3'
Posted On2016-06-08