Incidental Mutation 'R4543:Chil3'
ID392056
Institutional Source Beutler Lab
Gene Symbol Chil3
Ensembl Gene ENSMUSG00000040809
Gene Namechitinase-like 3
SynonymsYm1, Chi3l3
MMRRC Submission 041778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R4543 (G1)
Quality Score146
Status Validated
Chromosome3
Chromosomal Location106147554-106167564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 106160370 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 160 (K160Q)
Ref Sequence ENSEMBL: ENSMUSP00000053923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063062]
PDB Structure
THE CRYSTAL STRUCTURE OF NOVEL MAMMALIAN LECTIN YM1 SUGGESTS A SACCHARIDE BINDING SITE [X-RAY DIFFRACTION]
The Crystal Structure of Ym1 at 1.31 A Resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000063062
AA Change: K160Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053923
Gene: ENSMUSG00000040809
AA Change: K160Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 5.17e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129563
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to bacterial chitinases but lacks chitinase activity. The encoded protein is thought to function as a lectin and may be involved in inflammation and allergy. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,389,793 M101K probably benign Het
A1bg A T 15: 60,917,900 S500T probably damaging Het
Abhd3 T C 18: 10,706,672 D2G possibly damaging Het
Ablim1 C T 19: 57,077,442 R366H possibly damaging Het
Adgre1 T A 17: 57,406,874 H186Q probably benign Het
Ankmy1 G T 1: 92,884,850 A579E probably damaging Het
Ap2b1 C A 11: 83,324,650 T140K probably damaging Het
Arhgef28 T A 13: 98,075,000 E158D probably benign Het
Atp8b4 A G 2: 126,358,066 F885L probably damaging Het
Barx2 A G 9: 31,846,796 L282S unknown Het
Catsper2 C T 2: 121,407,409 W163* probably null Het
Cep295 T C 9: 15,335,253 T588A possibly damaging Het
Clca3a1 T A 3: 144,746,988 Q578L probably damaging Het
Crp A C 1: 172,698,737 I130L probably benign Het
Dtwd2 C A 18: 49,724,108 probably null Het
Fads3 T C 19: 10,041,811 F27S possibly damaging Het
Gm3604 T C 13: 62,370,156 D109G probably benign Het
Gtf2ird1 A G 5: 134,363,900 probably null Het
H2-K1 C T 17: 33,999,558 probably null Het
Hdac5 T C 11: 102,213,944 probably benign Het
Il6st G A 13: 112,481,459 V136M probably damaging Het
Immt T C 6: 71,851,778 S106P probably damaging Het
Kat2b T C 17: 53,653,140 I492T probably benign Het
Kcnn2 T C 18: 45,559,648 F97S probably benign Het
Kdm4c A G 4: 74,330,760 I84V probably benign Het
Kif7 G A 7: 79,707,548 P637S probably benign Het
Lrrcc1 T A 3: 14,539,791 I109K probably damaging Het
Med12l T A 3: 59,091,508 C619S probably damaging Het
Olfr919 A G 9: 38,697,545 S274P possibly damaging Het
Polq T C 16: 37,060,785 C1104R probably benign Het
Rbfox2 A T 15: 77,306,368 M59K probably benign Het
Rft1 T C 14: 30,661,333 V110A probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Slc2a12 T A 10: 22,664,786 V180D probably damaging Het
Sox21 CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC CCAGCGGCGGCGGCGGCAGCGGC 14: 118,235,136 probably benign Het
Stap2 C T 17: 55,997,604 probably null Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tmem132c A G 5: 127,504,977 T419A probably benign Het
Tmprss11a G A 5: 86,411,809 Q375* probably null Het
Trav12-3 CTCTG CTCTGTCTG 14: 53,622,236 probably null Het
Vmn1r88 T A 7: 13,177,980 S88T possibly damaging Het
Zfp622 T A 15: 25,991,537 D143E possibly damaging Het
Other mutations in Chil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chil3 APN 3 106148701 missense probably damaging 1.00
IGL01552:Chil3 APN 3 106148848 missense probably damaging 0.98
IGL02538:Chil3 APN 3 106164129 missense probably damaging 1.00
PIT4382001:Chil3 UTSW 3 106148659 missense probably damaging 1.00
R0145:Chil3 UTSW 3 106160478 missense probably damaging 1.00
R0269:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0310:Chil3 UTSW 3 106160523 missense possibly damaging 0.75
R0453:Chil3 UTSW 3 106148905 missense probably benign 0.26
R0541:Chil3 UTSW 3 106161232 critical splice acceptor site probably null
R0617:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0831:Chil3 UTSW 3 106149747 missense probably benign 0.19
R1699:Chil3 UTSW 3 106160366 critical splice donor site probably null
R1851:Chil3 UTSW 3 106148801 critical splice donor site probably null
R1852:Chil3 UTSW 3 106148801 critical splice donor site probably null
R2105:Chil3 UTSW 3 106160478 missense possibly damaging 0.73
R2202:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2204:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2205:Chil3 UTSW 3 106164246 missense probably benign 0.11
R4358:Chil3 UTSW 3 106160499 nonsense probably null
R4492:Chil3 UTSW 3 106155701 missense probably damaging 1.00
R4554:Chil3 UTSW 3 106160370 missense probably benign
R4930:Chil3 UTSW 3 106164208 missense possibly damaging 0.67
R5011:Chil3 UTSW 3 106150161 missense possibly damaging 0.46
R5083:Chil3 UTSW 3 106164089 critical splice donor site probably null
R5231:Chil3 UTSW 3 106155729 missense probably damaging 0.96
R5423:Chil3 UTSW 3 106148662 missense probably damaging 1.00
R6804:Chil3 UTSW 3 106164179 nonsense probably null
R6859:Chil3 UTSW 3 106160414 missense probably benign 0.14
R7218:Chil3 UTSW 3 106160537 splice site probably null
R7391:Chil3 UTSW 3 106164180 missense probably damaging 1.00
R7426:Chil3 UTSW 3 106155706 missense probably benign 0.05
R7582:Chil3 UTSW 3 106164256 missense probably damaging 1.00
R7620:Chil3 UTSW 3 106160435 missense probably damaging 1.00
R7647:Chil3 UTSW 3 106148806 missense possibly damaging 0.73
R7749:Chil3 UTSW 3 106148845 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATGCACTGTGGTTCTAACACAG -3'
(R):5'- AGGTGTCCATGTCATAGAAGTC -3'

Sequencing Primer
(F):5'- GCACTGTGGTTCTAACACAGCATAG -3'
(R):5'- GTGTCCATGTCATAGAAGTCTAACAC -3'
Posted On2016-06-09