Incidental Mutation 'R4543:Rbfox2'
ID 392058
Institutional Source Beutler Lab
Gene Symbol Rbfox2
Ensembl Gene ENSMUSG00000033565
Gene Name RNA binding protein, fox-1 homolog (C. elegans) 2
Synonyms 2810460A15Rik, Fxh, Fbm2, Rbm9
MMRRC Submission 041778-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.565) question?
Stock # R4543 (G1)
Quality Score 50
Status Validated
Chromosome 15
Chromosomal Location 77078990-77307004 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77306368 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 59 (M59K)
Ref Sequence ENSEMBL: ENSMUSP00000130739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048145] [ENSMUST00000171751] [ENSMUST00000228582]
AlphaFold Q8BP71
Predicted Effect probably benign
Transcript: ENSMUST00000048145
AA Change: M59K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000048056
Gene: ENSMUSG00000033565
AA Change: M59K

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 319 374 2.9e-18 PFAM
low complexity region 375 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171751
AA Change: M59K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130739
Gene: ENSMUSG00000033565
AA Change: M59K

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 324 421 7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228582
AA Change: M59K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0813 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit normal spontaneous and kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,389,793 M101K probably benign Het
A1bg A T 15: 60,917,900 S500T probably damaging Het
Abhd3 T C 18: 10,706,672 D2G possibly damaging Het
Ablim1 C T 19: 57,077,442 R366H possibly damaging Het
Adgre1 T A 17: 57,406,874 H186Q probably benign Het
Ankmy1 G T 1: 92,884,850 A579E probably damaging Het
Ap2b1 C A 11: 83,324,650 T140K probably damaging Het
Arhgef28 T A 13: 98,075,000 E158D probably benign Het
Atp8b4 A G 2: 126,358,066 F885L probably damaging Het
Barx2 A G 9: 31,846,796 L282S unknown Het
Catsper2 C T 2: 121,407,409 W163* probably null Het
Cep295 T C 9: 15,335,253 T588A possibly damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Clca3a1 T A 3: 144,746,988 Q578L probably damaging Het
Crp A C 1: 172,698,737 I130L probably benign Het
Dtwd2 C A 18: 49,724,108 probably null Het
Fads3 T C 19: 10,041,811 F27S possibly damaging Het
Gm3604 T C 13: 62,370,156 D109G probably benign Het
Gtf2ird1 A G 5: 134,363,900 probably null Het
H2-K1 C T 17: 33,999,558 probably null Het
Hdac5 T C 11: 102,213,944 probably benign Het
Il6st G A 13: 112,481,459 V136M probably damaging Het
Immt T C 6: 71,851,778 S106P probably damaging Het
Kat2b T C 17: 53,653,140 I492T probably benign Het
Kcnn2 T C 18: 45,559,648 F97S probably benign Het
Kdm4c A G 4: 74,330,760 I84V probably benign Het
Kif7 G A 7: 79,707,548 P637S probably benign Het
Lrrcc1 T A 3: 14,539,791 I109K probably damaging Het
Med12l T A 3: 59,091,508 C619S probably damaging Het
Olfr919 A G 9: 38,697,545 S274P possibly damaging Het
Polq T C 16: 37,060,785 C1104R probably benign Het
Rft1 T C 14: 30,661,333 V110A probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Slc2a12 T A 10: 22,664,786 V180D probably damaging Het
Sox21 CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC CCAGCGGCGGCGGCGGCAGCGGC 14: 118,235,136 probably benign Het
Stap2 C T 17: 55,997,604 probably null Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tmem132c A G 5: 127,504,977 T419A probably benign Het
Tmprss11a G A 5: 86,411,809 Q375* probably null Het
Trav12-3 CTCTG CTCTGTCTG 14: 53,622,236 probably null Het
Vmn1r88 T A 7: 13,177,980 S88T possibly damaging Het
Zfp622 T A 15: 25,991,537 D143E possibly damaging Het
Other mutations in Rbfox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Rbfox2 APN 15 77102936 missense probably damaging 1.00
R0026:Rbfox2 UTSW 15 77084157 missense possibly damaging 0.66
R0130:Rbfox2 UTSW 15 77091857 intron probably benign
R0446:Rbfox2 UTSW 15 77099255 missense probably damaging 0.98
R0731:Rbfox2 UTSW 15 77099279 missense probably benign 0.21
R3013:Rbfox2 UTSW 15 77132920 missense probably damaging 1.00
R3715:Rbfox2 UTSW 15 77099251 missense probably damaging 0.97
R4094:Rbfox2 UTSW 15 77132725 missense probably damaging 0.99
R4799:Rbfox2 UTSW 15 77091818 missense probably benign 0.28
R6194:Rbfox2 UTSW 15 77084157 missense possibly damaging 0.66
R7316:Rbfox2 UTSW 15 77132729 missense possibly damaging 0.92
R7501:Rbfox2 UTSW 15 77105634 missense probably benign 0.36
R7687:Rbfox2 UTSW 15 77306494 missense unknown
R8030:Rbfox2 UTSW 15 77085576 critical splice donor site probably null
R8103:Rbfox2 UTSW 15 77099454 missense probably damaging 1.00
R9093:Rbfox2 UTSW 15 77306458 missense probably benign
RF027:Rbfox2 UTSW 15 77132773 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCCGATCCTGTTCAATCCCAA -3'
(R):5'- CGACCAGTCAGCTCGCTG -3'

Sequencing Primer
(F):5'- TGTTCAATCCCAACTCCAAAAGG -3'
(R):5'- AGCCATAACCTGAGTCGGAGC -3'
Posted On 2016-06-09