Incidental Mutation 'IGL02802:Olfr1181'
ID392071
Institutional Source Beutler Lab
Gene Symbol Olfr1181
Ensembl Gene ENSMUSG00000075125
Gene Nameolfactory receptor 1181
SynonymsMOR225-9P, GA_x6K02T2Q125-49911636-49910701
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #IGL02802 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88420321-88426171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88423488 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000150939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099823] [ENSMUST00000102619] [ENSMUST00000213190] [ENSMUST00000216121] [ENSMUST00000217320]
Predicted Effect probably benign
Transcript: ENSMUST00000099823
AA Change: V179A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097411
Gene: ENSMUSG00000075125
AA Change: V179A

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 1.5e-48 PFAM
Pfam:7tm_1 39 285 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102619
AA Change: V179A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099679
Gene: ENSMUSG00000075125
AA Change: V179A

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 285 7.2e-26 PFAM
Pfam:7tm_4 137 278 3.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213190
AA Change: V179A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216121
Predicted Effect probably benign
Transcript: ENSMUST00000217320
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A C 1: 130,743,393 T451P probably benign Het
Actbl2 A G 13: 111,255,776 E215G probably damaging Het
Adh6b A G 3: 138,352,784 T198A possibly damaging Het
Bicd2 A G 13: 49,378,328 K349E probably damaging Het
Bsnd T A 4: 106,492,034 D3V probably damaging Het
Cd83 T A 13: 43,799,671 L142Q probably null Het
Cdh7 A G 1: 110,137,925 E643G probably damaging Het
Ces1b T G 8: 93,056,966 E542A possibly damaging Het
Cfhr2 A G 1: 139,811,024 probably benign Het
Clip1 T C 5: 123,631,123 D471G probably damaging Het
Cntn5 C A 9: 10,048,678 probably null Het
Cntnap2 A T 6: 46,170,245 D475V probably damaging Het
Cntnap5c T C 17: 58,305,684 F906S probably benign Het
Cobll1 A T 2: 65,098,319 S888T probably damaging Het
Csf2rb G A 15: 78,338,903 R105Q probably benign Het
Ctnnd1 C A 2: 84,624,462 M1I probably null Het
Cxxc1 C T 18: 74,219,410 Q354* probably null Het
Dnhd1 A G 7: 105,655,723 D324G possibly damaging Het
Donson T C 16: 91,681,308 D435G possibly damaging Het
Ephb1 T C 9: 102,010,019 K474E possibly damaging Het
Erbin A G 13: 103,868,130 L130P probably damaging Het
Fam221a C T 6: 49,378,477 T171I probably damaging Het
Farp2 A G 1: 93,528,610 E5G probably damaging Het
Fblim1 A G 4: 141,590,120 S85P possibly damaging Het
Fhl2 A T 1: 43,123,601 C251* probably null Het
Glis2 T C 16: 4,611,871 probably null Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10717 C T 9: 3,031,999 P127S probably benign Het
Heatr6 T C 11: 83,760,936 L246P probably damaging Het
Igkv5-39 G A 6: 69,900,473 P100S probably benign Het
Jup T C 11: 100,378,378 D403G probably benign Het
Kank1 T C 19: 25,411,599 Y879H probably damaging Het
Kcna3 G A 3: 107,037,053 E211K probably damaging Het
Klc3 A T 7: 19,395,124 I440N possibly damaging Het
Mmp1b T C 9: 7,384,709 T280A probably benign Het
Nat3 A T 8: 67,547,508 Q13L probably benign Het
Nckap1l A G 15: 103,464,536 N272S probably benign Het
Nrn1 C A 13: 36,730,106 probably null Het
Nsd3 T C 8: 25,640,906 S96P probably damaging Het
Nudt16l1 C T 16: 4,939,267 R43C probably damaging Het
Obscn T A 11: 59,000,484 Q7074L unknown Het
Olfr1024 A G 2: 85,904,389 S222P probably damaging Het
Olfr1076 T A 2: 86,508,946 N162K probably benign Het
Olfr506 A T 7: 108,612,462 I52F probably damaging Het
Olfr776 T A 10: 129,261,267 probably null Het
Olfr884 T G 9: 38,048,049 Y276D probably damaging Het
P4htm C T 9: 108,582,856 D240N probably benign Het
Papd4 A T 13: 93,148,941 N436K probably damaging Het
Plekhm2 A T 4: 141,642,524 probably benign Het
Plppr5 T C 3: 117,662,579 S250P probably damaging Het
Pmis2 T C 7: 30,671,494 K12E probably benign Het
Ppox A T 1: 171,277,493 L374* probably null Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Tdo2 A G 3: 81,975,697 probably benign Het
Thbs2 A G 17: 14,684,127 I326T probably benign Het
Thrap3 T C 4: 126,165,364 probably benign Het
Ttc6 A T 12: 57,575,868 M18L probably benign Het
Ttn C T 2: 76,774,580 V18337I probably damaging Het
Txndc2 A G 17: 65,639,606 S34P possibly damaging Het
Vps72 T A 3: 95,119,234 C163* probably null Het
Wdyhv1 A G 15: 58,148,437 S65G probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Other mutations in Olfr1181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Olfr1181 APN 2 88423786 missense probably benign 0.30
IGL02224:Olfr1181 APN 2 88423708 unclassified probably null
IGL03293:Olfr1181 APN 2 88423227 missense probably damaging 1.00
R2214:Olfr1181 UTSW 2 88423117 missense probably benign 0.00
R2508:Olfr1181 UTSW 2 88423456 missense possibly damaging 0.95
R4050:Olfr1181 UTSW 2 88423623 missense probably damaging 0.99
R5404:Olfr1181 UTSW 2 88423801 missense probably damaging 0.98
R5727:Olfr1181 UTSW 2 88423447 missense probably benign 0.00
R6578:Olfr1181 UTSW 2 88423144 missense probably benign 0.12
R6663:Olfr1181 UTSW 2 88423350 missense probably benign 0.25
R6974:Olfr1181 UTSW 2 88423812 missense possibly damaging 0.93
R7042:Olfr1181 UTSW 2 88423402 missense possibly damaging 0.89
R7659:Olfr1181 UTSW 2 88423926 missense probably damaging 1.00
X0018:Olfr1181 UTSW 2 88423662 missense probably benign
Z1177:Olfr1181 UTSW 2 88423815 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAAGAGCTTTGCGTCTCCC -3'
(R):5'- GCCATGCACTTCTTTGGAATG -3'

Sequencing Primer
(F):5'- CTTCTGCTGAGTAATTCCTTAATGTG -3'
(R):5'- ACAGTCATGGCCTTTGACCG -3'
Posted On2016-06-09