Incidental Mutation 'IGL02802:Zfp831'
ID392072
Institutional Source Beutler Lab
Gene Symbol Zfp831
Ensembl Gene ENSMUSG00000050600
Gene Namezinc finger protein 831
SynonymsENSMUSG00000050600, OTTMUSG00000017459
Accession Numbers

Genbank: NM_001099328; MGI: 3641861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02802 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174643534-174710832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 174645152 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 540 (I540N)
Ref Sequence ENSEMBL: ENSMUSP00000060255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059452
AA Change: I540N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060255
Gene: ENSMUSG00000050600
AA Change: I540N

DomainStartEndE-ValueType
low complexity region 120 135 N/A INTRINSIC
ZnF_C2H2 143 165 5.06e-2 SMART
ZnF_C2H2 171 195 7.78e-3 SMART
low complexity region 201 216 N/A INTRINSIC
low complexity region 237 248 N/A INTRINSIC
low complexity region 345 371 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 1520 1529 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A C 1: 130,743,393 T451P probably benign Het
Actbl2 A G 13: 111,255,776 E215G probably damaging Het
Adh6b A G 3: 138,352,784 T198A possibly damaging Het
Bicd2 A G 13: 49,378,328 K349E probably damaging Het
Bsnd T A 4: 106,492,034 D3V probably damaging Het
Cd83 T A 13: 43,799,671 L142Q probably null Het
Cdh7 A G 1: 110,137,925 E643G probably damaging Het
Ces1b T G 8: 93,056,966 E542A possibly damaging Het
Cfhr2 A G 1: 139,811,024 probably benign Het
Clip1 T C 5: 123,631,123 D471G probably damaging Het
Cntn5 C A 9: 10,048,678 probably null Het
Cntnap2 A T 6: 46,170,245 D475V probably damaging Het
Cntnap5c T C 17: 58,305,684 F906S probably benign Het
Cobll1 A T 2: 65,098,319 S888T probably damaging Het
Csf2rb G A 15: 78,338,903 R105Q probably benign Het
Ctnnd1 C A 2: 84,624,462 M1I probably null Het
Cxxc1 C T 18: 74,219,410 Q354* probably null Het
Dnhd1 A G 7: 105,655,723 D324G possibly damaging Het
Donson T C 16: 91,681,308 D435G possibly damaging Het
Ephb1 T C 9: 102,010,019 K474E possibly damaging Het
Erbin A G 13: 103,868,130 L130P probably damaging Het
Fam221a C T 6: 49,378,477 T171I probably damaging Het
Farp2 A G 1: 93,528,610 E5G probably damaging Het
Fblim1 A G 4: 141,590,120 S85P possibly damaging Het
Fhl2 A T 1: 43,123,601 C251* probably null Het
Glis2 T C 16: 4,611,871 probably null Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10717 C T 9: 3,031,999 P127S probably benign Het
Heatr6 T C 11: 83,760,936 L246P probably damaging Het
Igkv5-39 G A 6: 69,900,473 P100S probably benign Het
Jup T C 11: 100,378,378 D403G probably benign Het
Kank1 T C 19: 25,411,599 Y879H probably damaging Het
Kcna3 G A 3: 107,037,053 E211K probably damaging Het
Klc3 A T 7: 19,395,124 I440N possibly damaging Het
Mmp1b T C 9: 7,384,709 T280A probably benign Het
Nat3 A T 8: 67,547,508 Q13L probably benign Het
Nckap1l A G 15: 103,464,536 N272S probably benign Het
Nrn1 C A 13: 36,730,106 probably null Het
Nsd3 T C 8: 25,640,906 S96P probably damaging Het
Nudt16l1 C T 16: 4,939,267 R43C probably damaging Het
Obscn T A 11: 59,000,484 Q7074L unknown Het
Olfr1024 A G 2: 85,904,389 S222P probably damaging Het
Olfr1076 T A 2: 86,508,946 N162K probably benign Het
Olfr1181 A G 2: 88,423,488 V179A probably benign Het
Olfr506 A T 7: 108,612,462 I52F probably damaging Het
Olfr776 T A 10: 129,261,267 probably null Het
Olfr884 T G 9: 38,048,049 Y276D probably damaging Het
P4htm C T 9: 108,582,856 D240N probably benign Het
Papd4 A T 13: 93,148,941 N436K probably damaging Het
Plekhm2 A T 4: 141,642,524 probably benign Het
Plppr5 T C 3: 117,662,579 S250P probably damaging Het
Pmis2 T C 7: 30,671,494 K12E probably benign Het
Ppox A T 1: 171,277,493 L374* probably null Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Tdo2 A G 3: 81,975,697 probably benign Het
Thbs2 A G 17: 14,684,127 I326T probably benign Het
Thrap3 T C 4: 126,165,364 probably benign Het
Ttc6 A T 12: 57,575,868 M18L probably benign Het
Ttn C T 2: 76,774,580 V18337I probably damaging Het
Txndc2 A G 17: 65,639,606 S34P possibly damaging Het
Vps72 T A 3: 95,119,234 C163* probably null Het
Wdyhv1 A G 15: 58,148,437 S65G probably benign Het
Other mutations in Zfp831
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp831 APN 2 174646285 missense possibly damaging 0.86
IGL00091:Zfp831 APN 2 174645658 missense possibly damaging 0.73
IGL00764:Zfp831 APN 2 174645908 missense possibly damaging 0.72
IGL01538:Zfp831 APN 2 174644606 missense possibly damaging 0.72
IGL01700:Zfp831 APN 2 174644918 missense possibly damaging 0.86
IGL01718:Zfp831 APN 2 174643838 missense possibly damaging 0.86
IGL02221:Zfp831 APN 2 174643726 missense probably benign 0.33
IGL02250:Zfp831 APN 2 174648201 missense possibly damaging 0.53
IGL03209:Zfp831 APN 2 174645266 missense probably benign 0.40
D4043:Zfp831 UTSW 2 174645266 missense probably benign 0.40
FR4304:Zfp831 UTSW 2 174645481 small insertion probably benign
FR4340:Zfp831 UTSW 2 174645480 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645482 small insertion probably benign
FR4589:Zfp831 UTSW 2 174645468 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645476 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645483 small insertion probably benign
P0028:Zfp831 UTSW 2 174645346 missense possibly damaging 0.53
PIT4531001:Zfp831 UTSW 2 174646723 missense possibly damaging 0.90
R0631:Zfp831 UTSW 2 174645290 missense possibly damaging 0.53
R0644:Zfp831 UTSW 2 174645863 missense probably benign 0.33
R0782:Zfp831 UTSW 2 174646630 missense probably benign 0.06
R1156:Zfp831 UTSW 2 174646917 missense possibly damaging 0.53
R1280:Zfp831 UTSW 2 174704059 missense probably benign 0.00
R1709:Zfp831 UTSW 2 174645890 missense probably benign 0.33
R1883:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R1884:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R2127:Zfp831 UTSW 2 174648124 missense probably benign 0.33
R2137:Zfp831 UTSW 2 174705746 missense possibly damaging 0.53
R2268:Zfp831 UTSW 2 174644241 missense probably benign 0.01
R2330:Zfp831 UTSW 2 174648089 nonsense probably null
R3547:Zfp831 UTSW 2 174657683 missense probably benign
R3821:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R4163:Zfp831 UTSW 2 174644029 missense possibly damaging 0.53
R4232:Zfp831 UTSW 2 174705654 missense possibly damaging 0.96
R4778:Zfp831 UTSW 2 174646807 missense possibly damaging 0.53
R4820:Zfp831 UTSW 2 174705304 missense possibly damaging 0.73
R4912:Zfp831 UTSW 2 174644624 missense probably damaging 1.00
R5119:Zfp831 UTSW 2 174705310 missense probably benign 0.18
R5152:Zfp831 UTSW 2 174644564 missense probably benign 0.33
R5723:Zfp831 UTSW 2 174645407 missense probably benign 0.23
R5741:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
R5888:Zfp831 UTSW 2 174643627 missense probably benign 0.18
R5975:Zfp831 UTSW 2 174644092 missense possibly damaging 0.93
R6092:Zfp831 UTSW 2 174705506 missense probably damaging 0.98
R6158:Zfp831 UTSW 2 174643858 missense possibly damaging 0.53
R6212:Zfp831 UTSW 2 174645868 missense possibly damaging 0.53
R6233:Zfp831 UTSW 2 174646697 missense possibly damaging 0.85
R6248:Zfp831 UTSW 2 174644515 missense possibly damaging 0.53
R6255:Zfp831 UTSW 2 174646421 missense possibly damaging 0.96
R6460:Zfp831 UTSW 2 174646567 missense possibly damaging 0.46
R6477:Zfp831 UTSW 2 174704167 missense probably benign
R6864:Zfp831 UTSW 2 174646740 missense possibly damaging 0.72
R7396:Zfp831 UTSW 2 174645209 missense possibly damaging 0.73
R7447:Zfp831 UTSW 2 174646103 missense possibly damaging 0.88
R7499:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R7662:Zfp831 UTSW 2 174646141 missense possibly damaging 0.85
R7857:Zfp831 UTSW 2 174705242 missense probably benign 0.33
R7889:Zfp831 UTSW 2 174645304 missense possibly damaging 0.53
R7896:Zfp831 UTSW 2 174647128 missense possibly damaging 0.53
R7940:Zfp831 UTSW 2 174705242 missense probably benign 0.33
R7972:Zfp831 UTSW 2 174645304 missense possibly damaging 0.53
R7979:Zfp831 UTSW 2 174647128 missense possibly damaging 0.53
R8074:Zfp831 UTSW 2 174644735 missense possibly damaging 0.72
X0021:Zfp831 UTSW 2 174705869 missense possibly damaging 0.85
Z1177:Zfp831 UTSW 2 174644188 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTACAGTGGAGTGTGTCCC -3'
(R):5'- AAAGTCTCATTTCCATACACTTGCC -3'

Sequencing Primer
(F):5'- AGTGTGTCCCTGTCACCAGAAG -3'
(R):5'- ATACACTTGCCATTTCTCCTGGGAG -3'
Posted On2016-06-09