Incidental Mutation 'IGL02802:Kcna3'
ID392074
Institutional Source Beutler Lab
Gene Symbol Kcna3
Ensembl Gene ENSMUSG00000047959
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 3
SynonymsKv1.3, Mk-3, Kca1-3
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #IGL02802 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107036169-107038070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107037053 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 211 (E211K)
Ref Sequence ENSEMBL: ENSMUSP00000050680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052718]
Predicted Effect probably damaging
Transcript: ENSMUST00000052718
AA Change: E211K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050680
Gene: ENSMUSG00000047959
AA Change: E211K

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
BTB 57 157 6.9e-10 SMART
Pfam:Ion_trans 186 444 4.2e-54 PFAM
Pfam:Ion_trans_2 352 437 2.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070085
SMART Domains Protein: ENSMUSP00000066165
Gene: ENSMUSG00000056145

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182414
Meta Mutation Damage Score 0.1736 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display no apparent immune system defects. Mice homozygous for a different knock-out allele show reduced body weight, increased basal metabolic rate, resistance to diet-induced obesity, increased insulin sensitivity, and altered peripheral glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A C 1: 130,743,393 T451P probably benign Het
Actbl2 A G 13: 111,255,776 E215G probably damaging Het
Adh6b A G 3: 138,352,784 T198A possibly damaging Het
Bicd2 A G 13: 49,378,328 K349E probably damaging Het
Bsnd T A 4: 106,492,034 D3V probably damaging Het
Cd83 T A 13: 43,799,671 L142Q probably null Het
Cdh7 A G 1: 110,137,925 E643G probably damaging Het
Ces1b T G 8: 93,056,966 E542A possibly damaging Het
Cfhr2 A G 1: 139,811,024 probably benign Het
Clip1 T C 5: 123,631,123 D471G probably damaging Het
Cntn5 C A 9: 10,048,678 probably null Het
Cntnap2 A T 6: 46,170,245 D475V probably damaging Het
Cntnap5c T C 17: 58,305,684 F906S probably benign Het
Cobll1 A T 2: 65,098,319 S888T probably damaging Het
Csf2rb G A 15: 78,338,903 R105Q probably benign Het
Ctnnd1 C A 2: 84,624,462 M1I probably null Het
Cxxc1 C T 18: 74,219,410 Q354* probably null Het
Dnhd1 A G 7: 105,655,723 D324G possibly damaging Het
Donson T C 16: 91,681,308 D435G possibly damaging Het
Ephb1 T C 9: 102,010,019 K474E possibly damaging Het
Erbin A G 13: 103,868,130 L130P probably damaging Het
Fam221a C T 6: 49,378,477 T171I probably damaging Het
Farp2 A G 1: 93,528,610 E5G probably damaging Het
Fblim1 A G 4: 141,590,120 S85P possibly damaging Het
Fhl2 A T 1: 43,123,601 C251* probably null Het
Glis2 T C 16: 4,611,871 probably null Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10717 C T 9: 3,031,999 P127S probably benign Het
Heatr6 T C 11: 83,760,936 L246P probably damaging Het
Igkv5-39 G A 6: 69,900,473 P100S probably benign Het
Jup T C 11: 100,378,378 D403G probably benign Het
Kank1 T C 19: 25,411,599 Y879H probably damaging Het
Klc3 A T 7: 19,395,124 I440N possibly damaging Het
Mmp1b T C 9: 7,384,709 T280A probably benign Het
Nat3 A T 8: 67,547,508 Q13L probably benign Het
Nckap1l A G 15: 103,464,536 N272S probably benign Het
Nrn1 C A 13: 36,730,106 probably null Het
Nsd3 T C 8: 25,640,906 S96P probably damaging Het
Nudt16l1 C T 16: 4,939,267 R43C probably damaging Het
Obscn T A 11: 59,000,484 Q7074L unknown Het
Olfr1024 A G 2: 85,904,389 S222P probably damaging Het
Olfr1076 T A 2: 86,508,946 N162K probably benign Het
Olfr1181 A G 2: 88,423,488 V179A probably benign Het
Olfr506 A T 7: 108,612,462 I52F probably damaging Het
Olfr776 T A 10: 129,261,267 probably null Het
Olfr884 T G 9: 38,048,049 Y276D probably damaging Het
P4htm C T 9: 108,582,856 D240N probably benign Het
Papd4 A T 13: 93,148,941 N436K probably damaging Het
Plekhm2 A T 4: 141,642,524 probably benign Het
Plppr5 T C 3: 117,662,579 S250P probably damaging Het
Pmis2 T C 7: 30,671,494 K12E probably benign Het
Ppox A T 1: 171,277,493 L374* probably null Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Tdo2 A G 3: 81,975,697 probably benign Het
Thbs2 A G 17: 14,684,127 I326T probably benign Het
Thrap3 T C 4: 126,165,364 probably benign Het
Ttc6 A T 12: 57,575,868 M18L probably benign Het
Ttn C T 2: 76,774,580 V18337I probably damaging Het
Txndc2 A G 17: 65,639,606 S34P possibly damaging Het
Vps72 T A 3: 95,119,234 C163* probably null Het
Wdyhv1 A G 15: 58,148,437 S65G probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Other mutations in Kcna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Kcna3 APN 3 107037156 missense probably benign 0.33
IGL00562:Kcna3 APN 3 107036730 missense probably damaging 1.00
IGL01106:Kcna3 APN 3 107037864 missense possibly damaging 0.89
IGL01318:Kcna3 APN 3 107037978 missense probably benign 0.03
IGL02253:Kcna3 APN 3 107037411 missense probably damaging 1.00
IGL03379:Kcna3 APN 3 107037205 missense probably benign 0.05
IGL03014:Kcna3 UTSW 3 107037890 missense probably benign 0.00
R0393:Kcna3 UTSW 3 107036999 missense probably damaging 1.00
R1591:Kcna3 UTSW 3 107037029 missense probably damaging 1.00
R1922:Kcna3 UTSW 3 107037935 missense possibly damaging 0.47
R1950:Kcna3 UTSW 3 107037672 missense probably damaging 1.00
R3847:Kcna3 UTSW 3 107036696 missense possibly damaging 0.57
R4912:Kcna3 UTSW 3 107037891 missense probably benign
R6261:Kcna3 UTSW 3 107037950 missense possibly damaging 0.53
R6271:Kcna3 UTSW 3 107037606 missense probably damaging 1.00
R6334:Kcna3 UTSW 3 107036424 start codon destroyed probably null
R6423:Kcna3 UTSW 3 107036842 nonsense probably null
R6850:Kcna3 UTSW 3 107037159 missense probably damaging 1.00
R6901:Kcna3 UTSW 3 107036568 missense probably benign 0.00
R7193:Kcna3 UTSW 3 107036537 missense probably benign 0.02
R7524:Kcna3 UTSW 3 107037207 missense probably damaging 1.00
Z1088:Kcna3 UTSW 3 107036953 missense probably damaging 1.00
Z1176:Kcna3 UTSW 3 107037266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCGCTTTTACCAGCTGGG -3'
(R):5'- TTACTGGGGCAAGCAAAGAACC -3'

Sequencing Primer
(F):5'- CTGGGTGAGGAGGCCATG -3'
(R):5'- CGCACCAGAAGCTCAAAGGAG -3'
Posted On2016-06-09