Incidental Mutation 'IGL02802:Ces1b'
ID392092
Institutional Source Beutler Lab
Gene Symbol Ces1b
Ensembl Gene ENSMUSG00000078964
Gene Namecarboxylesterase 1B
SynonymsGm5158
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #IGL02802 (G1)
Quality Score77
Status Validated
Chromosome8
Chromosomal Location93056728-93080017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 93056966 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 542 (E542A)
Ref Sequence ENSEMBL: ENSMUSP00000105210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109582
AA Change: E542A

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105210
Gene: ENSMUSG00000078964
AA Change: E542A

DomainStartEndE-ValueType
Pfam:COesterase 1 547 7.6e-168 PFAM
Pfam:Abhydrolase_3 136 245 8.5e-11 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A C 1: 130,743,393 T451P probably benign Het
Actbl2 A G 13: 111,255,776 E215G probably damaging Het
Adh6b A G 3: 138,352,784 T198A possibly damaging Het
Bicd2 A G 13: 49,378,328 K349E probably damaging Het
Bsnd T A 4: 106,492,034 D3V probably damaging Het
Cd83 T A 13: 43,799,671 L142Q probably null Het
Cdh7 A G 1: 110,137,925 E643G probably damaging Het
Cfhr2 A G 1: 139,811,024 probably benign Het
Clip1 T C 5: 123,631,123 D471G probably damaging Het
Cntn5 C A 9: 10,048,678 probably null Het
Cntnap2 A T 6: 46,170,245 D475V probably damaging Het
Cntnap5c T C 17: 58,305,684 F906S probably benign Het
Cobll1 A T 2: 65,098,319 S888T probably damaging Het
Csf2rb G A 15: 78,338,903 R105Q probably benign Het
Ctnnd1 C A 2: 84,624,462 M1I probably null Het
Cxxc1 C T 18: 74,219,410 Q354* probably null Het
Dnhd1 A G 7: 105,655,723 D324G possibly damaging Het
Donson T C 16: 91,681,308 D435G possibly damaging Het
Ephb1 T C 9: 102,010,019 K474E possibly damaging Het
Erbin A G 13: 103,868,130 L130P probably damaging Het
Fam221a C T 6: 49,378,477 T171I probably damaging Het
Farp2 A G 1: 93,528,610 E5G probably damaging Het
Fblim1 A G 4: 141,590,120 S85P possibly damaging Het
Fhl2 A T 1: 43,123,601 C251* probably null Het
Glis2 T C 16: 4,611,871 probably null Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10717 C T 9: 3,031,999 P127S probably benign Het
Heatr6 T C 11: 83,760,936 L246P probably damaging Het
Igkv5-39 G A 6: 69,900,473 P100S probably benign Het
Jup T C 11: 100,378,378 D403G probably benign Het
Kank1 T C 19: 25,411,599 Y879H probably damaging Het
Kcna3 G A 3: 107,037,053 E211K probably damaging Het
Klc3 A T 7: 19,395,124 I440N possibly damaging Het
Mmp1b T C 9: 7,384,709 T280A probably benign Het
Nat3 A T 8: 67,547,508 Q13L probably benign Het
Nckap1l A G 15: 103,464,536 N272S probably benign Het
Nrn1 C A 13: 36,730,106 probably null Het
Nsd3 T C 8: 25,640,906 S96P probably damaging Het
Nudt16l1 C T 16: 4,939,267 R43C probably damaging Het
Obscn T A 11: 59,000,484 Q7074L unknown Het
Olfr1024 A G 2: 85,904,389 S222P probably damaging Het
Olfr1076 T A 2: 86,508,946 N162K probably benign Het
Olfr1181 A G 2: 88,423,488 V179A probably benign Het
Olfr506 A T 7: 108,612,462 I52F probably damaging Het
Olfr776 T A 10: 129,261,267 probably null Het
Olfr884 T G 9: 38,048,049 Y276D probably damaging Het
P4htm C T 9: 108,582,856 D240N probably benign Het
Papd4 A T 13: 93,148,941 N436K probably damaging Het
Plekhm2 A T 4: 141,642,524 probably benign Het
Plppr5 T C 3: 117,662,579 S250P probably damaging Het
Pmis2 T C 7: 30,671,494 K12E probably benign Het
Ppox A T 1: 171,277,493 L374* probably null Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Tdo2 A G 3: 81,975,697 probably benign Het
Thbs2 A G 17: 14,684,127 I326T probably benign Het
Thrap3 T C 4: 126,165,364 probably benign Het
Ttc6 A T 12: 57,575,868 M18L probably benign Het
Ttn C T 2: 76,774,580 V18337I probably damaging Het
Txndc2 A G 17: 65,639,606 S34P possibly damaging Het
Vps72 T A 3: 95,119,234 C163* probably null Het
Wdyhv1 A G 15: 58,148,437 S65G probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Other mutations in Ces1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ces1b APN 8 93071994 missense probably damaging 0.98
IGL01939:Ces1b APN 8 93079431 missense probably damaging 1.00
IGL02314:Ces1b APN 8 93064896 missense possibly damaging 0.95
IGL02338:Ces1b APN 8 93057047 missense possibly damaging 0.77
IGL02647:Ces1b APN 8 93057044 missense probably benign 0.00
IGL02833:Ces1b APN 8 93079410 missense probably damaging 1.00
IGL03038:Ces1b APN 8 93067052 missense probably benign
IGL03149:Ces1b APN 8 93064874 splice site probably benign
FR4548:Ces1b UTSW 8 93068092 missense probably null
R0382:Ces1b UTSW 8 93076052 splice site probably benign
R0893:Ces1b UTSW 8 93079428 missense probably benign 0.11
R0959:Ces1b UTSW 8 93068147 missense probably damaging 1.00
R1386:Ces1b UTSW 8 93068077 missense probably benign 0.02
R1440:Ces1b UTSW 8 93068108 missense probably damaging 0.97
R1667:Ces1b UTSW 8 93056904 missense possibly damaging 0.75
R2113:Ces1b UTSW 8 93068155 missense probably benign
R2193:Ces1b UTSW 8 93079877 missense probably benign 0.00
R2508:Ces1b UTSW 8 93073341 missense possibly damaging 0.75
R4656:Ces1b UTSW 8 93057414 missense probably damaging 0.96
R4776:Ces1b UTSW 8 93063030 missense possibly damaging 0.92
R5108:Ces1b UTSW 8 93071913 missense probably damaging 1.00
R5117:Ces1b UTSW 8 93073209 critical splice donor site probably null
R5308:Ces1b UTSW 8 93067017 missense probably benign 0.00
R5381:Ces1b UTSW 8 93065019 missense probably benign 0.02
R5392:Ces1b UTSW 8 93071962 missense probably damaging 0.98
R5614:Ces1b UTSW 8 93068208 missense probably benign 0.00
R5816:Ces1b UTSW 8 93073262 missense probably benign 0.05
R6554:Ces1b UTSW 8 93064991 missense probably benign 0.03
R6576:Ces1b UTSW 8 93056919 missense probably benign 0.06
R6601:Ces1b UTSW 8 93079481 missense probably benign
R6662:Ces1b UTSW 8 93064069 missense probably benign 0.33
R6753:Ces1b UTSW 8 93067020 nonsense probably null
R6904:Ces1b UTSW 8 93060410 missense probably damaging 0.96
R7267:Ces1b UTSW 8 93079504 missense possibly damaging 0.58
R7371:Ces1b UTSW 8 93057354 critical splice donor site probably null
R7396:Ces1b UTSW 8 93063129 missense probably benign 0.00
R7992:Ces1b UTSW 8 93060359 missense probably benign 0.34
R8022:Ces1b UTSW 8 93069315 critical splice donor site probably null
X0024:Ces1b UTSW 8 93063017 missense probably benign
Z1088:Ces1b UTSW 8 93064966 missense probably damaging 0.96
Z1177:Ces1b UTSW 8 93076154 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGTTTCCTCTGTAAGATCCATC -3'
(R):5'- CTCTCTATGGAGGTTGTCAGCC -3'

Sequencing Primer
(F):5'- GATCCATCTTTGGTGAATAGTCATCC -3'
(R):5'- AGGTTGTCAGCCTCACTACTGAG -3'
Posted On2016-06-09