Incidental Mutation 'IGL02802:Gm10717'
ID392093
Institutional Source Beutler Lab
Gene Symbol Gm10717
Ensembl Gene ENSMUSG00000095891
Gene Namepredicted gene 10717
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #IGL02802 (G1)
Quality Score87
Status Validated
Chromosome9
Chromosomal Location3025417-3033289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3031999 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 127 (P127S)
Ref Sequence ENSEMBL: ENSMUSP00000137451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099042] [ENSMUST00000099051] [ENSMUST00000099056] [ENSMUST00000155807] [ENSMUST00000177601] [ENSMUST00000177875] [ENSMUST00000178641] [ENSMUST00000179264] [ENSMUST00000179839] [ENSMUST00000179982]
Predicted Effect probably benign
Transcript: ENSMUST00000099042
SMART Domains Protein: ENSMUSP00000096640
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 47 9.09e-8 PROSPERO
transmembrane domain 76 98 N/A INTRINSIC
internal_repeat_1 117 164 9.09e-8 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099051
SMART Domains Protein: ENSMUSP00000096650
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 2 38 6.22e-5 PROSPERO
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
internal_repeat_1 118 174 6.22e-5 PROSPERO
transmembrane domain 185 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099056
SMART Domains Protein: ENSMUSP00000096655
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 50 9.96e-8 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 223 9.96e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000155807
SMART Domains Protein: ENSMUSP00000136448
Gene: ENSMUSG00000096201

DomainStartEndE-ValueType
internal_repeat_1 1 48 2.67e-7 PROSPERO
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 165 2.67e-7 PROSPERO
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177601
SMART Domains Protein: ENSMUSP00000136755
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_2 1 24 2.26e-6 PROSPERO
internal_repeat_1 2 37 2.26e-6 PROSPERO
internal_repeat_1 40 95 2.26e-6 PROSPERO
internal_repeat_2 118 142 2.26e-6 PROSPERO
low complexity region 147 159 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177875
SMART Domains Protein: ENSMUSP00000137419
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.49e-11 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 186 1.49e-11 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178641
SMART Domains Protein: ENSMUSP00000135988
Gene: ENSMUSG00000096736

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.86e-5 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 185 1.86e-5 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179264
AA Change: P127S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137451
Gene: ENSMUSG00000095891
AA Change: P127S

DomainStartEndE-ValueType
internal_repeat_1 1 43 5.09e-6 PROSPERO
transmembrane domain 69 91 N/A INTRINSIC
internal_repeat_1 117 179 5.09e-6 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179839
SMART Domains Protein: ENSMUSP00000136837
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 46 1.07e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 182 1.07e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179982
SMART Domains Protein: ENSMUSP00000136365
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 35 7.76e-13 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 152 7.76e-13 PROSPERO
low complexity region 157 169 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181957
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A C 1: 130,743,393 T451P probably benign Het
Actbl2 A G 13: 111,255,776 E215G probably damaging Het
Adh6b A G 3: 138,352,784 T198A possibly damaging Het
Bicd2 A G 13: 49,378,328 K349E probably damaging Het
Bsnd T A 4: 106,492,034 D3V probably damaging Het
Cd83 T A 13: 43,799,671 L142Q probably null Het
Cdh7 A G 1: 110,137,925 E643G probably damaging Het
Ces1b T G 8: 93,056,966 E542A possibly damaging Het
Cfhr2 A G 1: 139,811,024 probably benign Het
Clip1 T C 5: 123,631,123 D471G probably damaging Het
Cntn5 C A 9: 10,048,678 probably null Het
Cntnap2 A T 6: 46,170,245 D475V probably damaging Het
Cntnap5c T C 17: 58,305,684 F906S probably benign Het
Cobll1 A T 2: 65,098,319 S888T probably damaging Het
Csf2rb G A 15: 78,338,903 R105Q probably benign Het
Ctnnd1 C A 2: 84,624,462 M1I probably null Het
Cxxc1 C T 18: 74,219,410 Q354* probably null Het
Dnhd1 A G 7: 105,655,723 D324G possibly damaging Het
Donson T C 16: 91,681,308 D435G possibly damaging Het
Ephb1 T C 9: 102,010,019 K474E possibly damaging Het
Erbin A G 13: 103,868,130 L130P probably damaging Het
Fam221a C T 6: 49,378,477 T171I probably damaging Het
Farp2 A G 1: 93,528,610 E5G probably damaging Het
Fblim1 A G 4: 141,590,120 S85P possibly damaging Het
Fhl2 A T 1: 43,123,601 C251* probably null Het
Glis2 T C 16: 4,611,871 probably null Het
Gm10715 A C 9: 3,038,062 probably benign Het
Heatr6 T C 11: 83,760,936 L246P probably damaging Het
Igkv5-39 G A 6: 69,900,473 P100S probably benign Het
Jup T C 11: 100,378,378 D403G probably benign Het
Kank1 T C 19: 25,411,599 Y879H probably damaging Het
Kcna3 G A 3: 107,037,053 E211K probably damaging Het
Klc3 A T 7: 19,395,124 I440N possibly damaging Het
Mmp1b T C 9: 7,384,709 T280A probably benign Het
Nat3 A T 8: 67,547,508 Q13L probably benign Het
Nckap1l A G 15: 103,464,536 N272S probably benign Het
Nrn1 C A 13: 36,730,106 probably null Het
Nsd3 T C 8: 25,640,906 S96P probably damaging Het
Nudt16l1 C T 16: 4,939,267 R43C probably damaging Het
Obscn T A 11: 59,000,484 Q7074L unknown Het
Olfr1024 A G 2: 85,904,389 S222P probably damaging Het
Olfr1076 T A 2: 86,508,946 N162K probably benign Het
Olfr1181 A G 2: 88,423,488 V179A probably benign Het
Olfr506 A T 7: 108,612,462 I52F probably damaging Het
Olfr776 T A 10: 129,261,267 probably null Het
Olfr884 T G 9: 38,048,049 Y276D probably damaging Het
P4htm C T 9: 108,582,856 D240N probably benign Het
Papd4 A T 13: 93,148,941 N436K probably damaging Het
Plekhm2 A T 4: 141,642,524 probably benign Het
Plppr5 T C 3: 117,662,579 S250P probably damaging Het
Pmis2 T C 7: 30,671,494 K12E probably benign Het
Ppox A T 1: 171,277,493 L374* probably null Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Tdo2 A G 3: 81,975,697 probably benign Het
Thbs2 A G 17: 14,684,127 I326T probably benign Het
Thrap3 T C 4: 126,165,364 probably benign Het
Ttc6 A T 12: 57,575,868 M18L probably benign Het
Ttn C T 2: 76,774,580 V18337I probably damaging Het
Txndc2 A G 17: 65,639,606 S34P possibly damaging Het
Vps72 T A 3: 95,119,234 C163* probably null Het
Wdyhv1 A G 15: 58,148,437 S65G probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Other mutations in Gm10717
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Gm10717 APN 9 3025511 missense probably damaging 1.00
IGL01635:Gm10717 APN 9 3025506 missense possibly damaging 0.46
IGL01864:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01865:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01865:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01866:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01873:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01875:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01877:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01877:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01878:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01879:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01880:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01882:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01886:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01887:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01892:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01893:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01897:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01901:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01903:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01904:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01907:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01907:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01908:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01913:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01919:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01920:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01923:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01925:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01927:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01930:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01931:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01932:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01935:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01941:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01948:Gm10717 APN 9 3025819 missense probably damaging 1.00
IGL01949:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01951:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01952:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL02106:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02142:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL02592:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02609:Gm10717 APN 9 3026287 missense probably damaging 0.98
R0277:Gm10717 UTSW 9 3025619 missense possibly damaging 0.79
R1813:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R1911:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R2399:Gm10717 UTSW 9 3025532 missense probably benign
R2874:Gm10717 UTSW 9 3025532 missense probably benign
R3617:Gm10717 UTSW 9 3025532 missense probably benign
R3720:Gm10717 UTSW 9 3025532 missense probably benign
R4988:Gm10717 UTSW 9 3026368 missense probably benign 0.00
R5002:Gm10717 UTSW 9 3025532 missense probably benign
R5117:Gm10717 UTSW 9 3025625 missense probably benign 0.00
R5367:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R5539:Gm10717 UTSW 9 3030438 missense probably damaging 1.00
R5623:Gm10717 UTSW 9 3026318 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGTCCTACAGTGTGCAT -3'
(R):5'- CCACTGTAGGACATGGAATATGGC -3'

Sequencing Primer
(F):5'- AGGTCCTACAGTGTGCATTTCTC -3'
(R):5'- CACACTTTAGGACGTGAAATATGGC -3'
Posted On2016-06-09