Incidental Mutation 'IGL02802:Ephb1'
ID392098
Institutional Source Beutler Lab
Gene Symbol Ephb1
Ensembl Gene ENSMUSG00000032537
Gene NameEph receptor B1
SynonymsCek6, Net, C130099E04Rik, Hek6, Elk, Elkh
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02802 (G1)
Quality Score140
Status Validated
Chromosome9
Chromosomal Location101922128-102354693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102010019 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 474 (K474E)
Ref Sequence ENSEMBL: ENSMUSP00000082261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035129] [ENSMUST00000085169]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035129
AA Change: K474E

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035129
Gene: ENSMUSG00000032537
AA Change: K474E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
Pfam:EphA2_TM 542 616 3e-24 PFAM
TyrKc 619 878 6.45e-141 SMART
SAM 908 975 1.22e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085169
AA Change: K474E

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082261
Gene: ENSMUSG00000032537
AA Change: K474E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
transmembrane domain 541 563 N/A INTRINSIC
TyrKc 585 837 2.35e-134 SMART
SAM 867 934 1.22e-21 SMART
Meta Mutation Damage Score 0.4012 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene display marked reductions of the ipsilateral optic tract. Homozygotes for one null allele show reduced corticospinal tract and abnormal anterior commissure axon crossing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A C 1: 130,743,393 T451P probably benign Het
Actbl2 A G 13: 111,255,776 E215G probably damaging Het
Adh6b A G 3: 138,352,784 T198A possibly damaging Het
Bicd2 A G 13: 49,378,328 K349E probably damaging Het
Bsnd T A 4: 106,492,034 D3V probably damaging Het
Cd83 T A 13: 43,799,671 L142Q probably null Het
Cdh7 A G 1: 110,137,925 E643G probably damaging Het
Ces1b T G 8: 93,056,966 E542A possibly damaging Het
Cfhr2 A G 1: 139,811,024 probably benign Het
Clip1 T C 5: 123,631,123 D471G probably damaging Het
Cntn5 C A 9: 10,048,678 probably null Het
Cntnap2 A T 6: 46,170,245 D475V probably damaging Het
Cntnap5c T C 17: 58,305,684 F906S probably benign Het
Cobll1 A T 2: 65,098,319 S888T probably damaging Het
Csf2rb G A 15: 78,338,903 R105Q probably benign Het
Ctnnd1 C A 2: 84,624,462 M1I probably null Het
Cxxc1 C T 18: 74,219,410 Q354* probably null Het
Dnhd1 A G 7: 105,655,723 D324G possibly damaging Het
Donson T C 16: 91,681,308 D435G possibly damaging Het
Erbin A G 13: 103,868,130 L130P probably damaging Het
Fam221a C T 6: 49,378,477 T171I probably damaging Het
Farp2 A G 1: 93,528,610 E5G probably damaging Het
Fblim1 A G 4: 141,590,120 S85P possibly damaging Het
Fhl2 A T 1: 43,123,601 C251* probably null Het
Glis2 T C 16: 4,611,871 probably null Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10717 C T 9: 3,031,999 P127S probably benign Het
Heatr6 T C 11: 83,760,936 L246P probably damaging Het
Igkv5-39 G A 6: 69,900,473 P100S probably benign Het
Jup T C 11: 100,378,378 D403G probably benign Het
Kank1 T C 19: 25,411,599 Y879H probably damaging Het
Kcna3 G A 3: 107,037,053 E211K probably damaging Het
Klc3 A T 7: 19,395,124 I440N possibly damaging Het
Mmp1b T C 9: 7,384,709 T280A probably benign Het
Nat3 A T 8: 67,547,508 Q13L probably benign Het
Nckap1l A G 15: 103,464,536 N272S probably benign Het
Nrn1 C A 13: 36,730,106 probably null Het
Nsd3 T C 8: 25,640,906 S96P probably damaging Het
Nudt16l1 C T 16: 4,939,267 R43C probably damaging Het
Obscn T A 11: 59,000,484 Q7074L unknown Het
Olfr1024 A G 2: 85,904,389 S222P probably damaging Het
Olfr1076 T A 2: 86,508,946 N162K probably benign Het
Olfr1181 A G 2: 88,423,488 V179A probably benign Het
Olfr506 A T 7: 108,612,462 I52F probably damaging Het
Olfr776 T A 10: 129,261,267 probably null Het
Olfr884 T G 9: 38,048,049 Y276D probably damaging Het
P4htm C T 9: 108,582,856 D240N probably benign Het
Papd4 A T 13: 93,148,941 N436K probably damaging Het
Plekhm2 A T 4: 141,642,524 probably benign Het
Plppr5 T C 3: 117,662,579 S250P probably damaging Het
Pmis2 T C 7: 30,671,494 K12E probably benign Het
Ppox A T 1: 171,277,493 L374* probably null Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Tdo2 A G 3: 81,975,697 probably benign Het
Thbs2 A G 17: 14,684,127 I326T probably benign Het
Thrap3 T C 4: 126,165,364 probably benign Het
Ttc6 A T 12: 57,575,868 M18L probably benign Het
Ttn C T 2: 76,774,580 V18337I probably damaging Het
Txndc2 A G 17: 65,639,606 S34P possibly damaging Het
Vps72 T A 3: 95,119,234 C163* probably null Het
Wdyhv1 A G 15: 58,148,437 S65G probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Other mutations in Ephb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Ephb1 APN 9 101996787 missense probably damaging 1.00
IGL01910:Ephb1 APN 9 102001857 missense probably benign 0.00
IGL02006:Ephb1 APN 9 102194772 critical splice donor site probably null
IGL02660:Ephb1 APN 9 102041092 missense possibly damaging 0.94
IGL02685:Ephb1 APN 9 102041103 nonsense probably null
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0180:Ephb1 UTSW 9 101927504 missense probably damaging 0.99
R0488:Ephb1 UTSW 9 101964008 missense probably damaging 1.00
R0511:Ephb1 UTSW 9 101995980 splice site probably benign
R0601:Ephb1 UTSW 9 102195130 missense probably damaging 1.00
R1622:Ephb1 UTSW 9 102001711 missense probably benign 0.00
R1643:Ephb1 UTSW 9 101996825 missense probably damaging 0.99
R1645:Ephb1 UTSW 9 101927559 missense probably damaging 1.00
R1914:Ephb1 UTSW 9 101929378 missense probably damaging 1.00
R1964:Ephb1 UTSW 9 101971123 missense possibly damaging 0.93
R2245:Ephb1 UTSW 9 101996774 splice site probably benign
R2247:Ephb1 UTSW 9 101996811 missense probably damaging 0.98
R2412:Ephb1 UTSW 9 102001816 missense possibly damaging 0.85
R3716:Ephb1 UTSW 9 102194800 missense probably damaging 1.00
R3756:Ephb1 UTSW 9 102041039 missense probably benign 0.01
R3797:Ephb1 UTSW 9 101971267 missense probably damaging 1.00
R3907:Ephb1 UTSW 9 102001726 missense probably benign 0.00
R4981:Ephb1 UTSW 9 102040960 missense probably benign
R5112:Ephb1 UTSW 9 101971179 missense probably damaging 1.00
R5507:Ephb1 UTSW 9 101936116 missense probably damaging 1.00
R5745:Ephb1 UTSW 9 102195434 missense probably benign 0.25
R6082:Ephb1 UTSW 9 101971104 missense probably damaging 1.00
R6183:Ephb1 UTSW 9 102195325 missense probably damaging 1.00
R6228:Ephb1 UTSW 9 101923584 missense probably damaging 1.00
R6572:Ephb1 UTSW 9 102066898 missense probably benign
R6596:Ephb1 UTSW 9 102194802 nonsense probably null
R6813:Ephb1 UTSW 9 102010048 missense possibly damaging 0.87
R6876:Ephb1 UTSW 9 101984120 missense probably damaging 1.00
R6922:Ephb1 UTSW 9 101929264 splice site probably null
R6950:Ephb1 UTSW 9 102194909 missense probably benign 0.03
R7144:Ephb1 UTSW 9 101964077 missense probably damaging 1.00
R7146:Ephb1 UTSW 9 101963958 missense probably damaging 1.00
R7328:Ephb1 UTSW 9 102195239 missense probably damaging 1.00
R7644:Ephb1 UTSW 9 101936194 missense probably damaging 1.00
R7737:Ephb1 UTSW 9 101984103 missense probably damaging 1.00
X0064:Ephb1 UTSW 9 101971272 missense probably damaging 1.00
Z1088:Ephb1 UTSW 9 101984145 missense probably damaging 0.99
Z1176:Ephb1 UTSW 9 102223398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAACTGTCCAGACTGTCAG -3'
(R):5'- GGCACTTCTCCTGTATCGAC -3'

Sequencing Primer
(F):5'- GGCGTCTAAAGGTTCTATCCCAAG -3'
(R):5'- GTATCGACCGTCCCTTCAG -3'
Posted On2016-06-09