Incidental Mutation 'IGL02802:Donson'
ID392117
Institutional Source Beutler Lab
Gene Symbol Donson
Ensembl Gene ENSMUSG00000022960
Gene Namedownstream neighbor of SON
SynonymsDonson, ORF60, 1110025J21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #IGL02802 (G1)
Quality Score95
Status Validated
Chromosome16
Chromosomal Location91676808-91688770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91681308 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 435 (D435G)
Ref Sequence ENSEMBL: ENSMUSP00000121591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023682] [ENSMUST00000114031] [ENSMUST00000114037] [ENSMUST00000117159] [ENSMUST00000117633] [ENSMUST00000122302] [ENSMUST00000133942] [ENSMUST00000136699] [ENSMUST00000138560] [ENSMUST00000139324] [ENSMUST00000140312] [ENSMUST00000144461] [ENSMUST00000145833] [ENSMUST00000159295]
Predicted Effect probably benign
Transcript: ENSMUST00000023682
AA Change: D465G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023682
Gene: ENSMUSG00000022960
AA Change: D465G

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114031
SMART Domains Protein: ENSMUSP00000109665
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114037
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117159
SMART Domains Protein: ENSMUSP00000113220
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117633
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123893
Predicted Effect possibly damaging
Transcript: ENSMUST00000133942
AA Change: D253G

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121386
Gene: ENSMUSG00000022960
AA Change: D253G

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136699
Predicted Effect possibly damaging
Transcript: ENSMUST00000138560
AA Change: D435G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121591
Gene: ENSMUSG00000022960
AA Change: D435G

DomainStartEndE-ValueType
low complexity region 31 52 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139324
SMART Domains Protein: ENSMUSP00000120957
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140312
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144461
SMART Domains Protein: ENSMUSP00000123648
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145235
Predicted Effect probably benign
Transcript: ENSMUST00000145833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147461
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151503
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231425
Predicted Effect unknown
Transcript: ENSMUST00000231459
AA Change: D1G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232177
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene lies downstream of the SON gene and spans 10 kb on chromosome 21. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is early embryonic lethal. Heterozygous knockout causes no observable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A C 1: 130,743,393 T451P probably benign Het
Actbl2 A G 13: 111,255,776 E215G probably damaging Het
Adh6b A G 3: 138,352,784 T198A possibly damaging Het
Bicd2 A G 13: 49,378,328 K349E probably damaging Het
Bsnd T A 4: 106,492,034 D3V probably damaging Het
Cd83 T A 13: 43,799,671 L142Q probably null Het
Cdh7 A G 1: 110,137,925 E643G probably damaging Het
Ces1b T G 8: 93,056,966 E542A possibly damaging Het
Cfhr2 A G 1: 139,811,024 probably benign Het
Clip1 T C 5: 123,631,123 D471G probably damaging Het
Cntn5 C A 9: 10,048,678 probably null Het
Cntnap2 A T 6: 46,170,245 D475V probably damaging Het
Cntnap5c T C 17: 58,305,684 F906S probably benign Het
Cobll1 A T 2: 65,098,319 S888T probably damaging Het
Csf2rb G A 15: 78,338,903 R105Q probably benign Het
Ctnnd1 C A 2: 84,624,462 M1I probably null Het
Cxxc1 C T 18: 74,219,410 Q354* probably null Het
Dnhd1 A G 7: 105,655,723 D324G possibly damaging Het
Ephb1 T C 9: 102,010,019 K474E possibly damaging Het
Erbin A G 13: 103,868,130 L130P probably damaging Het
Fam221a C T 6: 49,378,477 T171I probably damaging Het
Farp2 A G 1: 93,528,610 E5G probably damaging Het
Fblim1 A G 4: 141,590,120 S85P possibly damaging Het
Fhl2 A T 1: 43,123,601 C251* probably null Het
Glis2 T C 16: 4,611,871 probably null Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10717 C T 9: 3,031,999 P127S probably benign Het
Heatr6 T C 11: 83,760,936 L246P probably damaging Het
Igkv5-39 G A 6: 69,900,473 P100S probably benign Het
Jup T C 11: 100,378,378 D403G probably benign Het
Kank1 T C 19: 25,411,599 Y879H probably damaging Het
Kcna3 G A 3: 107,037,053 E211K probably damaging Het
Klc3 A T 7: 19,395,124 I440N possibly damaging Het
Mmp1b T C 9: 7,384,709 T280A probably benign Het
Nat3 A T 8: 67,547,508 Q13L probably benign Het
Nckap1l A G 15: 103,464,536 N272S probably benign Het
Nrn1 C A 13: 36,730,106 probably null Het
Nsd3 T C 8: 25,640,906 S96P probably damaging Het
Nudt16l1 C T 16: 4,939,267 R43C probably damaging Het
Obscn T A 11: 59,000,484 Q7074L unknown Het
Olfr1024 A G 2: 85,904,389 S222P probably damaging Het
Olfr1076 T A 2: 86,508,946 N162K probably benign Het
Olfr1181 A G 2: 88,423,488 V179A probably benign Het
Olfr506 A T 7: 108,612,462 I52F probably damaging Het
Olfr776 T A 10: 129,261,267 probably null Het
Olfr884 T G 9: 38,048,049 Y276D probably damaging Het
P4htm C T 9: 108,582,856 D240N probably benign Het
Papd4 A T 13: 93,148,941 N436K probably damaging Het
Plekhm2 A T 4: 141,642,524 probably benign Het
Plppr5 T C 3: 117,662,579 S250P probably damaging Het
Pmis2 T C 7: 30,671,494 K12E probably benign Het
Ppox A T 1: 171,277,493 L374* probably null Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Tdo2 A G 3: 81,975,697 probably benign Het
Thbs2 A G 17: 14,684,127 I326T probably benign Het
Thrap3 T C 4: 126,165,364 probably benign Het
Ttc6 A T 12: 57,575,868 M18L probably benign Het
Ttn C T 2: 76,774,580 V18337I probably damaging Het
Txndc2 A G 17: 65,639,606 S34P possibly damaging Het
Vps72 T A 3: 95,119,234 C163* probably null Het
Wdyhv1 A G 15: 58,148,437 S65G probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Other mutations in Donson
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Donson APN 16 91682591 missense possibly damaging 0.79
IGL02458:Donson APN 16 91681176 missense probably damaging 0.97
IGL03238:Donson APN 16 91681246 nonsense probably null
R0525:Donson UTSW 16 91686245 missense probably damaging 1.00
R0831:Donson UTSW 16 91683763 missense probably damaging 1.00
R3706:Donson UTSW 16 91686161 unclassified probably benign
R4191:Donson UTSW 16 91688592 missense possibly damaging 0.81
R4746:Donson UTSW 16 91682237 missense probably damaging 1.00
R4788:Donson UTSW 16 91687833 missense possibly damaging 0.66
R4947:Donson UTSW 16 91682551 missense probably damaging 1.00
R5171:Donson UTSW 16 91681293 missense possibly damaging 0.93
R5439:Donson UTSW 16 91679926 missense probably damaging 0.99
R5739:Donson UTSW 16 91681229 splice site probably null
R5809:Donson UTSW 16 91687850 missense possibly damaging 0.69
R6964:Donson UTSW 16 91681219 missense probably benign 0.11
R7022:Donson UTSW 16 91681330 missense probably damaging 1.00
R7110:Donson UTSW 16 91682121 nonsense probably null
R7326:Donson UTSW 16 91688711 start codon destroyed probably null 0.99
R7826:Donson UTSW 16 91688456 missense possibly damaging 0.90
Z1177:Donson UTSW 16 91688472 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCACAAGTGACATTTACCCC -3'
(R):5'- TAGACAAGCAGCTTGACCAAGTC -3'

Sequencing Primer
(F):5'- TTTACCCCAGCAAGAGGATATAG -3'
(R):5'- CAAGTCGCATTCCCAGGAGTTTTG -3'
Posted On2016-06-09