Incidental Mutation 'IGL02980:St7'
ID392135
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Namesuppression of tumorigenicity 7
SynonymsRAY1, SEN4, Fam4a2, TSG7, 9430001H04Rik, HELG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #IGL02980 (G1)
Quality Score205
Status Validated
Chromosome6
Chromosomal Location17692933-17943025 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 17749546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000125673] [ENSMUST00000144488] [ENSMUST00000150281]
Predicted Effect probably benign
Transcript: ENSMUST00000000674
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052113
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053148
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077080
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081635
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115417
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115418
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115419
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115420
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125673
SMART Domains Protein: ENSMUSP00000122970
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 52 1.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect probably benign
Transcript: ENSMUST00000144488
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202649
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,473 H232Y unknown Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Adam28 A T 14: 68,619,806 S584T probably benign Het
Akap1 A T 11: 88,845,164 I224N probably benign Het
Ankdd1b C T 13: 96,435,940 R214Q probably benign Het
Armt1 A G 10: 4,450,643 probably benign Het
C1rl T C 6: 124,508,528 I286T probably benign Het
Cdh23 T C 10: 60,314,620 T2528A probably damaging Het
Col4a4 A G 1: 82,469,477 probably null Het
Dag1 A G 9: 108,218,038 I85T probably benign Het
Elf2 A G 3: 51,264,958 V86A possibly damaging Het
Emsy T C 7: 98,619,380 T485A probably damaging Het
Fam169a T C 13: 97,113,680 probably null Het
Hsd17b4 A G 18: 50,146,518 H188R probably benign Het
Ighv9-2 C T 12: 114,109,219 V45M probably damaging Het
Kif1bp A C 10: 62,559,168 L565W probably damaging Het
Lama3 C T 18: 12,553,231 L2784F probably benign Het
Ms4a4c G T 19: 11,416,383 A64S probably benign Het
Nudt22 A G 19: 6,993,132 L280P probably damaging Het
Oscar T C 7: 3,611,063 probably benign Het
Paics A G 5: 76,966,255 I321V probably benign Het
Pappa A T 4: 65,307,774 H1288L probably benign Het
Pla2r1 T C 2: 60,515,046 E322G possibly damaging Het
Poldip2 T A 11: 78,521,228 M330K probably damaging Het
Recql5 T C 11: 115,893,944 probably null Het
Rnf145 A G 11: 44,561,657 M488V probably benign Het
Rrp1b T A 17: 32,050,039 D170E possibly damaging Het
Slamf7 T C 1: 171,640,998 S109G possibly damaging Het
Slf1 A G 13: 77,044,004 S904P possibly damaging Het
Stk25 A G 1: 93,627,668 S102P probably damaging Het
Supt6 C T 11: 78,225,722 A659T probably damaging Het
Tdrp A C 8: 13,953,918 S140A probably damaging Het
Thbs3 A G 3: 89,223,144 N527D probably benign Het
Tsnaxip1 G T 8: 105,842,210 V444L probably damaging Het
U2af2 A G 7: 5,068,043 I116V probably benign Het
Zfp931 C A 2: 178,069,616 probably null Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17855006 missense probably damaging 1.00
IGL01312:St7 APN 6 17922014 missense probably damaging 1.00
IGL01562:St7 APN 6 17922035 missense probably damaging 0.99
IGL01935:St7 APN 6 17930823 missense probably damaging 0.99
IGL02127:St7 APN 6 17844969 intron probably benign
IGL02954:St7 APN 6 17848031 missense probably damaging 1.00
R0457:St7 UTSW 6 17819282 missense probably damaging 1.00
R0666:St7 UTSW 6 17934239 missense probably damaging 1.00
R0680:St7 UTSW 6 17942733 missense probably damaging 0.99
R1575:St7 UTSW 6 17886111 missense probably damaging 1.00
R2039:St7 UTSW 6 17886112 missense probably damaging 1.00
R2144:St7 UTSW 6 17886007 missense possibly damaging 0.58
R2194:St7 UTSW 6 17942719 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2873:St7 UTSW 6 17819277 missense probably damaging 1.00
R2874:St7 UTSW 6 17819277 missense probably damaging 1.00
R2970:St7 UTSW 6 17844909 missense probably damaging 1.00
R3076:St7 UTSW 6 17846238 nonsense probably null
R3921:St7 UTSW 6 17846245 missense probably benign 0.31
R4326:St7 UTSW 6 17819288 missense probably damaging 1.00
R4327:St7 UTSW 6 17819288 missense probably damaging 1.00
R4410:St7 UTSW 6 17854933 nonsense probably null
R4732:St7 UTSW 6 17906516 splice site probably null
R4733:St7 UTSW 6 17906516 splice site probably null
R4868:St7 UTSW 6 17819266 missense probably damaging 1.00
R4988:St7 UTSW 6 17934226 missense probably damaging 0.99
R5132:St7 UTSW 6 17854957 missense probably damaging 0.97
R5182:St7 UTSW 6 17846237 missense probably damaging 0.99
R5195:St7 UTSW 6 17743637 intron probably benign
R5358:St7 UTSW 6 17819318 missense probably damaging 1.00
R5502:St7 UTSW 6 17834674 missense possibly damaging 0.94
R5882:St7 UTSW 6 17846249 missense probably damaging 1.00
R5976:St7 UTSW 6 17694222 missense possibly damaging 0.93
R6049:St7 UTSW 6 17694348 missense possibly damaging 0.92
R6139:St7 UTSW 6 17694354 missense probably damaging 1.00
R6177:St7 UTSW 6 17819334 critical splice donor site probably null
R6181:St7 UTSW 6 17694364 critical splice donor site probably null
R6401:St7 UTSW 6 17855318 unclassified probably null
R6546:St7 UTSW 6 17852314 missense probably damaging 1.00
R6711:St7 UTSW 6 17848070 missense possibly damaging 0.82
R6898:St7 UTSW 6 17854946 missense probably damaging 1.00
R7536:St7 UTSW 6 17886020 missense probably damaging 0.99
R7583:St7 UTSW 6 17942754 missense possibly damaging 0.54
R7626:St7 UTSW 6 17934217 missense probably damaging 1.00
R7718:St7 UTSW 6 17854999 missense probably damaging 0.99
Z1176:St7 UTSW 6 17848045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCTCTTCGATTTGGGCTG -3'
(R):5'- GGACCAGTTCCTCTGTAATTAGAG -3'

Sequencing Primer
(F):5'- GCTGGTGTAGGAGCCCTG -3'
(R):5'- GAGGCAAATGCAAATATTACTAACC -3'
Posted On2016-06-09