Incidental Mutation 'IGL02980:C1rl'
ID392136
Institutional Source Beutler Lab
Gene Symbol C1rl
Ensembl Gene ENSMUSG00000038527
Gene Namecomplement component 1, r subcomponent-like
SynonymsC1rl1, C1r-LP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02980 (G1)
Quality Score219
Status Validated
Chromosome6
Chromosomal Location124493113-124510643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124508528 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 286 (I286T)
Ref Sequence ENSEMBL: ENSMUSP00000042883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049124] [ENSMUST00000068593]
Predicted Effect probably benign
Transcript: ENSMUST00000049124
AA Change: I286T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000042883
Gene: ENSMUSG00000038527
AA Change: I286T

DomainStartEndE-ValueType
CUB 42 166 3.19e-18 SMART
Tryp_SPc 239 474 1.25e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068593
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,473 H232Y unknown Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Adam28 A T 14: 68,619,806 S584T probably benign Het
Akap1 A T 11: 88,845,164 I224N probably benign Het
Ankdd1b C T 13: 96,435,940 R214Q probably benign Het
Armt1 A G 10: 4,450,643 probably benign Het
Cdh23 T C 10: 60,314,620 T2528A probably damaging Het
Col4a4 A G 1: 82,469,477 probably null Het
Dag1 A G 9: 108,218,038 I85T probably benign Het
Elf2 A G 3: 51,264,958 V86A possibly damaging Het
Emsy T C 7: 98,619,380 T485A probably damaging Het
Fam169a T C 13: 97,113,680 probably null Het
Hsd17b4 A G 18: 50,146,518 H188R probably benign Het
Ighv9-2 C T 12: 114,109,219 V45M probably damaging Het
Kif1bp A C 10: 62,559,168 L565W probably damaging Het
Lama3 C T 18: 12,553,231 L2784F probably benign Het
Ms4a4c G T 19: 11,416,383 A64S probably benign Het
Nudt22 A G 19: 6,993,132 L280P probably damaging Het
Oscar T C 7: 3,611,063 probably benign Het
Paics A G 5: 76,966,255 I321V probably benign Het
Pappa A T 4: 65,307,774 H1288L probably benign Het
Pla2r1 T C 2: 60,515,046 E322G possibly damaging Het
Poldip2 T A 11: 78,521,228 M330K probably damaging Het
Recql5 T C 11: 115,893,944 probably null Het
Rnf145 A G 11: 44,561,657 M488V probably benign Het
Rrp1b T A 17: 32,050,039 D170E possibly damaging Het
Slamf7 T C 1: 171,640,998 S109G possibly damaging Het
Slf1 A G 13: 77,044,004 S904P possibly damaging Het
St7 C A 6: 17,749,546 probably benign Het
Stk25 A G 1: 93,627,668 S102P probably damaging Het
Supt6 C T 11: 78,225,722 A659T probably damaging Het
Tdrp A C 8: 13,953,918 S140A probably damaging Het
Thbs3 A G 3: 89,223,144 N527D probably benign Het
Tsnaxip1 G T 8: 105,842,210 V444L probably damaging Het
U2af2 A G 7: 5,068,043 I116V probably benign Het
Zfp931 C A 2: 178,069,616 probably null Het
Other mutations in C1rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02435:C1rl APN 6 124508873 missense probably damaging 1.00
IGL02549:C1rl APN 6 124493837 missense possibly damaging 0.76
IGL02581:C1rl APN 6 124493154 missense possibly damaging 0.83
IGL02642:C1rl APN 6 124493847 missense possibly damaging 0.60
IGL02950:C1rl APN 6 124508861 missense probably damaging 1.00
R0699:C1rl UTSW 6 124508636 missense probably benign 0.14
R0848:C1rl UTSW 6 124508506 missense probably benign 0.29
R1221:C1rl UTSW 6 124493981 missense probably benign 0.43
R1654:C1rl UTSW 6 124493910 missense probably damaging 0.97
R1957:C1rl UTSW 6 124509062 missense probably damaging 1.00
R2055:C1rl UTSW 6 124493822 missense probably benign 0.01
R2120:C1rl UTSW 6 124508713 missense probably damaging 0.99
R2262:C1rl UTSW 6 124506948 missense probably damaging 0.99
R2363:C1rl UTSW 6 124509110 missense probably benign 0.13
R3933:C1rl UTSW 6 124508822 nonsense probably null
R4824:C1rl UTSW 6 124509081 nonsense probably null
R5228:C1rl UTSW 6 124508468 missense probably damaging 1.00
R5414:C1rl UTSW 6 124508468 missense probably damaging 1.00
R6008:C1rl UTSW 6 124493188 missense probably benign 0.00
R6467:C1rl UTSW 6 124508576 missense probably benign 0.03
R6549:C1rl UTSW 6 124508528 missense probably benign 0.00
R6609:C1rl UTSW 6 124508624 missense probably benign 0.44
R6998:C1rl UTSW 6 124508902 missense probably damaging 1.00
R7037:C1rl UTSW 6 124508639 missense probably damaging 1.00
Z1088:C1rl UTSW 6 124508742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTAATCTCTCACGGTTGTTGATC -3'
(R):5'- TGCTCAAGTTCCAGGAGAGC -3'

Sequencing Primer
(F):5'- CCTCACTTGCAGTCTGTGG -3'
(R):5'- TGCTCAAGTTCCAGGAGAGCAATATC -3'
Posted On2016-06-09