Incidental Mutation 'IGL02980:Emsy'
ID392138
Institutional Source Beutler Lab
Gene Symbol Emsy
Ensembl Gene ENSMUSG00000035401
Gene NameEMSY, BRCA2-interacting transcriptional repressor
Synonyms2210018M11Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #IGL02980 (G1)
Quality Score83
Status Validated
Chromosome7
Chromosomal Location98587137-98656783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98619380 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 485 (T485A)
Ref Sequence ENSEMBL: ENSMUSP00000146150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038359] [ENSMUST00000205276] [ENSMUST00000205911] [ENSMUST00000206619] [ENSMUST00000206626]
Predicted Effect probably damaging
Transcript: ENSMUST00000038359
AA Change: T499A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038216
Gene: ENSMUSG00000035401
AA Change: T499A

DomainStartEndE-ValueType
ENT 16 88 2.44e-29 SMART
low complexity region 94 104 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
low complexity region 293 331 N/A INTRINSIC
low complexity region 363 406 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 681 698 N/A INTRINSIC
low complexity region 807 816 N/A INTRINSIC
low complexity region 866 882 N/A INTRINSIC
low complexity region 893 909 N/A INTRINSIC
low complexity region 1197 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205276
AA Change: T499A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205911
AA Change: T460A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000206619
AA Change: T485A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000206626
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,473 H232Y unknown Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Adam28 A T 14: 68,619,806 S584T probably benign Het
Akap1 A T 11: 88,845,164 I224N probably benign Het
Ankdd1b C T 13: 96,435,940 R214Q probably benign Het
Armt1 A G 10: 4,450,643 probably benign Het
C1rl T C 6: 124,508,528 I286T probably benign Het
Cdh23 T C 10: 60,314,620 T2528A probably damaging Het
Col4a4 A G 1: 82,469,477 probably null Het
Dag1 A G 9: 108,218,038 I85T probably benign Het
Elf2 A G 3: 51,264,958 V86A possibly damaging Het
Fam169a T C 13: 97,113,680 probably null Het
Hsd17b4 A G 18: 50,146,518 H188R probably benign Het
Ighv9-2 C T 12: 114,109,219 V45M probably damaging Het
Kif1bp A C 10: 62,559,168 L565W probably damaging Het
Lama3 C T 18: 12,553,231 L2784F probably benign Het
Ms4a4c G T 19: 11,416,383 A64S probably benign Het
Nudt22 A G 19: 6,993,132 L280P probably damaging Het
Oscar T C 7: 3,611,063 probably benign Het
Paics A G 5: 76,966,255 I321V probably benign Het
Pappa A T 4: 65,307,774 H1288L probably benign Het
Pla2r1 T C 2: 60,515,046 E322G possibly damaging Het
Poldip2 T A 11: 78,521,228 M330K probably damaging Het
Recql5 T C 11: 115,893,944 probably null Het
Rnf145 A G 11: 44,561,657 M488V probably benign Het
Rrp1b T A 17: 32,050,039 D170E possibly damaging Het
Slamf7 T C 1: 171,640,998 S109G possibly damaging Het
Slf1 A G 13: 77,044,004 S904P possibly damaging Het
St7 C A 6: 17,749,546 probably benign Het
Stk25 A G 1: 93,627,668 S102P probably damaging Het
Supt6 C T 11: 78,225,722 A659T probably damaging Het
Tdrp A C 8: 13,953,918 S140A probably damaging Het
Thbs3 A G 3: 89,223,144 N527D probably benign Het
Tsnaxip1 G T 8: 105,842,210 V444L probably damaging Het
U2af2 A G 7: 5,068,043 I116V probably benign Het
Zfp931 C A 2: 178,069,616 probably null Het
Other mutations in Emsy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Emsy APN 7 98593455 missense probably benign 0.09
IGL01357:Emsy APN 7 98590870 nonsense probably null
IGL01620:Emsy APN 7 98626624 missense probably damaging 1.00
IGL01750:Emsy APN 7 98619301 missense probably damaging 0.99
IGL02032:Emsy APN 7 98590780 missense possibly damaging 0.94
IGL02388:Emsy APN 7 98641666 missense probably damaging 0.99
IGL03089:Emsy APN 7 98637266 nonsense probably null
IGL03272:Emsy APN 7 98593762 missense probably damaging 0.98
IGL03347:Emsy APN 7 98610685 missense probably damaging 0.99
IGL03400:Emsy APN 7 98602726 missense possibly damaging 0.94
R0576:Emsy UTSW 7 98593776 missense probably damaging 0.99
R1102:Emsy UTSW 7 98602589 missense probably damaging 0.97
R1323:Emsy UTSW 7 98610657 splice site probably benign
R1438:Emsy UTSW 7 98621406 missense possibly damaging 0.88
R1439:Emsy UTSW 7 98600841 intron probably benign
R1452:Emsy UTSW 7 98600674 missense probably damaging 0.96
R1515:Emsy UTSW 7 98590856 missense probably damaging 1.00
R1535:Emsy UTSW 7 98593737 missense possibly damaging 0.94
R1791:Emsy UTSW 7 98647880 missense probably damaging 0.99
R1829:Emsy UTSW 7 98602729 missense possibly damaging 0.95
R1829:Emsy UTSW 7 98602730 missense possibly damaging 0.88
R1848:Emsy UTSW 7 98600821 missense probably damaging 0.99
R1861:Emsy UTSW 7 98641615 missense probably damaging 1.00
R1929:Emsy UTSW 7 98626623 missense probably damaging 0.99
R1957:Emsy UTSW 7 98647820 missense probably damaging 1.00
R2221:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2223:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2271:Emsy UTSW 7 98626623 missense probably damaging 0.99
R4078:Emsy UTSW 7 98590725 missense probably damaging 0.99
R4707:Emsy UTSW 7 98597104 missense possibly damaging 0.94
R4783:Emsy UTSW 7 98646479 missense possibly damaging 0.74
R5453:Emsy UTSW 7 98600806 missense probably damaging 0.97
R5518:Emsy UTSW 7 98593611 missense possibly damaging 0.86
R5828:Emsy UTSW 7 98593492 missense probably benign
R5945:Emsy UTSW 7 98619383 missense probably damaging 0.97
R6153:Emsy UTSW 7 98610853 missense probably damaging 1.00
R6824:Emsy UTSW 7 98593407 missense probably benign 0.27
R7068:Emsy UTSW 7 98610761 missense probably benign 0.17
R7381:Emsy UTSW 7 98590803 missense probably damaging 0.98
R7417:Emsy UTSW 7 98615486 missense probably damaging 1.00
R7488:Emsy UTSW 7 98615555 missense possibly damaging 0.94
R7499:Emsy UTSW 7 98630331 missense possibly damaging 0.59
R7646:Emsy UTSW 7 98619353 missense probably damaging 1.00
R7682:Emsy UTSW 7 98590698 missense probably damaging 0.99
R7716:Emsy UTSW 7 98599766 missense unknown
R7789:Emsy UTSW 7 98621489 missense probably damaging 1.00
R7794:Emsy UTSW 7 98600724 missense probably benign 0.30
R7832:Emsy UTSW 7 98639853 missense probably damaging 1.00
R7974:Emsy UTSW 7 98630218 missense possibly damaging 0.73
R7996:Emsy UTSW 7 98593681 missense probably benign 0.00
R8070:Emsy UTSW 7 98626715 missense possibly damaging 0.73
R8221:Emsy UTSW 7 98647904 missense probably damaging 1.00
X0067:Emsy UTSW 7 98630240 missense possibly damaging 0.65
Z1088:Emsy UTSW 7 98600722 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAAACACAGTGCCACATTTTG -3'
(R):5'- TGAATGCCTTGGCACCTTGC -3'

Sequencing Primer
(F):5'- GAAACATGGCTTGTCTCC -3'
(R):5'- GCACCTTGCAGTTCCATTTTCAAG -3'
Posted On2016-06-09