Incidental Mutation 'R0442:Gimap9'
ID39214
Institutional Source Beutler Lab
Gene Symbol Gimap9
Ensembl Gene ENSMUSG00000051124
Gene NameGTPase, IMAP family member 9
Synonyms
MMRRC Submission 038643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0442 (G1)
Quality Score178
Status Validated
Chromosome6
Chromosomal Location48676129-48679114 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 48678066 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 196 (G196*)
Ref Sequence ENSEMBL: ENSMUSP00000050330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054050] [ENSMUST00000147936]
Predicted Effect probably null
Transcript: ENSMUST00000054050
AA Change: G196*
SMART Domains Protein: ENSMUSP00000050330
Gene: ENSMUSG00000051124
AA Change: G196*

DomainStartEndE-ValueType
Pfam:AIG1 9 219 8.5e-83 PFAM
Pfam:MMR_HSR1 10 157 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147936
SMART Domains Protein: ENSMUSP00000122830
Gene: ENSMUSG00000051124

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 123 7.3e-11 PFAM
Pfam:AIG1 1 138 5.6e-61 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.4%
  • 20x: 81.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,396,470 N816Y probably damaging Het
Arfgef3 T C 10: 18,677,815 probably benign Het
Cd200 T A 16: 45,397,155 S58C probably damaging Het
Cep128 C T 12: 91,266,771 E508K probably damaging Het
Dnah2 C A 11: 69,448,542 L3046F probably damaging Het
Duox2 T C 2: 122,289,332 N872D probably benign Het
Fam90a1a C T 8: 21,963,058 T143I probably benign Het
Fdft1 T C 14: 63,163,349 T112A probably benign Het
Grhl1 G A 12: 24,612,170 R536Q probably damaging Het
Gtpbp3 T A 8: 71,491,491 V293E probably damaging Het
Hcn3 A T 3: 89,151,540 F251Y probably damaging Het
Hectd4 T A 5: 121,323,982 C971S possibly damaging Het
Helz2 T A 2: 181,232,209 D2164V probably damaging Het
Hif1an T G 19: 44,566,012 L188R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqgap3 C T 3: 88,115,959 P519L probably damaging Het
Jakmip1 T G 5: 37,135,553 probably null Het
Klra1 T C 6: 130,372,872 Y201C probably damaging Het
Minpp1 T C 19: 32,493,948 F299L possibly damaging Het
Myb A G 10: 21,126,196 S749P probably benign Het
Myo3b T C 2: 70,238,961 probably null Het
Naip1 T A 13: 100,444,516 R74S probably benign Het
Nt5m A G 11: 59,874,619 T158A possibly damaging Het
Obscn A T 11: 59,002,174 probably benign Het
Olfr1475 T G 19: 13,480,048 D50A probably damaging Het
Olfr312 T A 11: 58,831,431 Y92* probably null Het
Olfr800 T C 10: 129,659,824 I6T probably benign Het
Otogl T A 10: 107,876,855 T543S probably damaging Het
Pds5b T C 5: 150,716,544 probably benign Het
Plekhm1 A G 11: 103,397,174 M49T possibly damaging Het
Rabl6 A T 2: 25,587,522 S305R probably damaging Het
Rad54b G A 4: 11,609,480 probably benign Het
Rad54b C A 4: 11,610,362 R660S probably benign Het
Rexo5 T C 7: 119,843,285 L542P probably damaging Het
Rp1 C T 1: 4,346,747 D1381N probably benign Het
Scnn1a T G 6: 125,339,137 M346R probably damaging Het
Sirpb1c A G 3: 15,802,546 I380T probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sstr3 A T 15: 78,540,397 L50Q probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Sun5 T C 2: 153,870,952 D16G possibly damaging Het
Svil A T 18: 5,046,870 T39S probably damaging Het
Taar1 A G 10: 23,920,482 Y26C possibly damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Use1 T C 8: 71,367,058 probably benign Het
Usp54 T C 14: 20,607,209 Y7C probably damaging Het
Zbtb37 A G 1: 161,032,348 F129S possibly damaging Het
Zfhx2 T C 14: 55,066,900 H1209R possibly damaging Het
Zfp28 T C 7: 6,394,999 L811P probably damaging Het
Zfp616 T C 11: 74,084,495 I530T possibly damaging Het
Other mutations in Gimap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Gimap9 APN 6 48677917 critical splice donor site probably null
IGL01568:Gimap9 APN 6 48677616 missense probably benign 0.07
R1354:Gimap9 UTSW 6 48678048 missense probably benign 0.24
R2276:Gimap9 UTSW 6 48677878 missense probably benign 0.00
R6190:Gimap9 UTSW 6 48678351 missense probably damaging 1.00
R6930:Gimap9 UTSW 6 48677667 missense probably damaging 1.00
R7116:Gimap9 UTSW 6 48678055 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCGACTGGACCGTTACACTGA -3'
(R):5'- AAAACAATTTGTGCCGCCTTTCCTT -3'

Sequencing Primer
(F):5'- AACGGTCGCTCTGATCAAG -3'
(R):5'- GCCTTTCCTTTTTCTAATTTAGCAG -3'
Posted On2013-05-23