Incidental Mutation 'IGL02980:Dag1'
ID392141
Institutional Source Beutler Lab
Gene Symbol Dag1
Ensembl Gene ENSMUSG00000039952
Gene Namedystroglycan 1
SynonymsD9Wsu13e, dystrophin associated glycoprotein 1, beta-dystroglycan, DG, alpha-dystroglycan
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #IGL02980 (G1)
Quality Score223
Status Validated
Chromosome9
Chromosomal Location108204634-108263958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108218038 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 85 (I85T)
Ref Sequence ENSEMBL: ENSMUSP00000142109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080435] [ENSMUST00000166905] [ENSMUST00000171412] [ENSMUST00000191899] [ENSMUST00000194698] [ENSMUST00000195429]
Predicted Effect probably benign
Transcript: ENSMUST00000080435
AA Change: I85T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000079294
Gene: ENSMUSG00000039952
AA Change: I85T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166905
AA Change: I85T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128531
Gene: ENSMUSG00000039952
AA Change: I85T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.5e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171412
AA Change: I85T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130626
Gene: ENSMUSG00000039952
AA Change: I85T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191899
AA Change: I85T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142109
Gene: ENSMUSG00000039952
AA Change: I85T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194698
Predicted Effect probably benign
Transcript: ENSMUST00000195429
Meta Mutation Damage Score 0.5232 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteolytic processing to generate alpha and beta subunits. A complete lack of the encoded protein in mice results in embryonic lethality due to the disorganization of Reichert's membrane. Chimeric mice deficient in the encoded protein overcome embryonic lethality but develop a progressive muscular dystrophy. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mutant embryos show gross abnormalities, particularly defective Reichert's membrane by 6.5 days, indicating a possible role for this gene product in basement membrane organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,473 H232Y unknown Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Adam28 A T 14: 68,619,806 S584T probably benign Het
Akap1 A T 11: 88,845,164 I224N probably benign Het
Ankdd1b C T 13: 96,435,940 R214Q probably benign Het
Armt1 A G 10: 4,450,643 probably benign Het
C1rl T C 6: 124,508,528 I286T probably benign Het
Cdh23 T C 10: 60,314,620 T2528A probably damaging Het
Col4a4 A G 1: 82,469,477 probably null Het
Elf2 A G 3: 51,264,958 V86A possibly damaging Het
Emsy T C 7: 98,619,380 T485A probably damaging Het
Fam169a T C 13: 97,113,680 probably null Het
Hsd17b4 A G 18: 50,146,518 H188R probably benign Het
Ighv9-2 C T 12: 114,109,219 V45M probably damaging Het
Kif1bp A C 10: 62,559,168 L565W probably damaging Het
Lama3 C T 18: 12,553,231 L2784F probably benign Het
Ms4a4c G T 19: 11,416,383 A64S probably benign Het
Nudt22 A G 19: 6,993,132 L280P probably damaging Het
Oscar T C 7: 3,611,063 probably benign Het
Paics A G 5: 76,966,255 I321V probably benign Het
Pappa A T 4: 65,307,774 H1288L probably benign Het
Pla2r1 T C 2: 60,515,046 E322G possibly damaging Het
Poldip2 T A 11: 78,521,228 M330K probably damaging Het
Recql5 T C 11: 115,893,944 probably null Het
Rnf145 A G 11: 44,561,657 M488V probably benign Het
Rrp1b T A 17: 32,050,039 D170E possibly damaging Het
Slamf7 T C 1: 171,640,998 S109G possibly damaging Het
Slf1 A G 13: 77,044,004 S904P possibly damaging Het
St7 C A 6: 17,749,546 probably benign Het
Stk25 A G 1: 93,627,668 S102P probably damaging Het
Supt6 C T 11: 78,225,722 A659T probably damaging Het
Tdrp A C 8: 13,953,918 S140A probably damaging Het
Thbs3 A G 3: 89,223,144 N527D probably benign Het
Tsnaxip1 G T 8: 105,842,210 V444L probably damaging Het
U2af2 A G 7: 5,068,043 I116V probably benign Het
Zfp931 C A 2: 178,069,616 probably null Het
Other mutations in Dag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Dag1 APN 9 108209288 missense probably damaging 0.99
IGL00780:Dag1 APN 9 108209619 missense probably damaging 1.00
IGL01488:Dag1 APN 9 108208303 missense probably benign 0.33
IGL01843:Dag1 APN 9 108208082 missense possibly damaging 0.92
IGL02140:Dag1 APN 9 108218192 missense probably damaging 1.00
R0037:Dag1 UTSW 9 108207353 missense probably damaging 0.99
R0172:Dag1 UTSW 9 108208832 missense possibly damaging 0.58
R0513:Dag1 UTSW 9 108208485 missense possibly damaging 0.93
R1715:Dag1 UTSW 9 108208715 missense possibly damaging 0.92
R2328:Dag1 UTSW 9 108209252 missense probably damaging 0.99
R2337:Dag1 UTSW 9 108207397 nonsense probably null
R3765:Dag1 UTSW 9 108208199 missense probably damaging 1.00
R4478:Dag1 UTSW 9 108208730 missense probably damaging 1.00
R5000:Dag1 UTSW 9 108208017 missense probably benign
R5127:Dag1 UTSW 9 108207572 missense possibly damaging 0.86
R5235:Dag1 UTSW 9 108207698 missense probably damaging 0.98
R5265:Dag1 UTSW 9 108207699 missense possibly damaging 0.93
R5315:Dag1 UTSW 9 108209117 missense probably damaging 1.00
R5620:Dag1 UTSW 9 108209015 missense probably damaging 1.00
R5696:Dag1 UTSW 9 108209447 missense probably benign 0.09
R5731:Dag1 UTSW 9 108218111 missense probably benign
R6382:Dag1 UTSW 9 108208137 missense possibly damaging 0.83
R6652:Dag1 UTSW 9 108209090 missense probably damaging 1.00
R6757:Dag1 UTSW 9 108218017 missense probably damaging 0.99
R6870:Dag1 UTSW 9 108209258 missense probably damaging 1.00
R7316:Dag1 UTSW 9 108209502 missense probably benign 0.00
R7343:Dag1 UTSW 9 108209093 missense possibly damaging 0.88
R7543:Dag1 UTSW 9 108218081 missense probably benign
R7733:Dag1 UTSW 9 108208848 missense probably benign 0.33
Z1088:Dag1 UTSW 9 108208668 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCTTAAAGGAGGAATGGCTCAG -3'
(R):5'- TGTGGACAACTGGCTACTGC -3'

Sequencing Primer
(F):5'- GCAGGCACACATGTGGTATTCATAC -3'
(R):5'- TGGGGACAGACCTTTCTCC -3'
Posted On2016-06-09