Incidental Mutation 'IGL02980:Kif1bp'
ID392144
Institutional Source Beutler Lab
Gene Symbol Kif1bp
Ensembl Gene ENSMUSG00000036955
Gene NameKIF1 binding protein
Synonyms2510003E04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02980 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62538626-62578457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 62559168 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 565 (L565W)
Ref Sequence ENSEMBL: ENSMUSP00000065160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065887] [ENSMUST00000159704] [ENSMUST00000162525] [ENSMUST00000162648] [ENSMUST00000162759]
Predicted Effect probably damaging
Transcript: ENSMUST00000065887
AA Change: L565W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065160
Gene: ENSMUSG00000036955
AA Change: L565W

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 243 610 6.6e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159704
SMART Domains Protein: ENSMUSP00000134770
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 383 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162263
Predicted Effect probably benign
Transcript: ENSMUST00000162525
SMART Domains Protein: ENSMUSP00000125162
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 6e-6 BLAST
Pfam:KBP_C 242 293 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162648
Predicted Effect probably benign
Transcript: ENSMUST00000162759
SMART Domains Protein: ENSMUSP00000125236
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 329 4.8e-28 PFAM
transmembrane domain 340 362 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208223
Meta Mutation Damage Score 0.3821 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin family member 1 binding protein that is characterized by two tetratrico peptide repeats. The encoded protein localizes to the mitochondria and may be involved in regulating transport of the mitochondria. Mutations in this gene are associated with Goldberg-Shprintzen megacolon syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous KO mice die shortly after birth from respiratory failure. Knockout affects innervation of the digestive tract, and the development of the olfactory bulb and the anterior commissure in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,473 H232Y unknown Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Adam28 A T 14: 68,619,806 S584T probably benign Het
Akap1 A T 11: 88,845,164 I224N probably benign Het
Ankdd1b C T 13: 96,435,940 R214Q probably benign Het
Armt1 A G 10: 4,450,643 probably benign Het
C1rl T C 6: 124,508,528 I286T probably benign Het
Cdh23 T C 10: 60,314,620 T2528A probably damaging Het
Col4a4 A G 1: 82,469,477 probably null Het
Dag1 A G 9: 108,218,038 I85T probably benign Het
Elf2 A G 3: 51,264,958 V86A possibly damaging Het
Emsy T C 7: 98,619,380 T485A probably damaging Het
Fam169a T C 13: 97,113,680 probably null Het
Hsd17b4 A G 18: 50,146,518 H188R probably benign Het
Ighv9-2 C T 12: 114,109,219 V45M probably damaging Het
Lama3 C T 18: 12,553,231 L2784F probably benign Het
Ms4a4c G T 19: 11,416,383 A64S probably benign Het
Nudt22 A G 19: 6,993,132 L280P probably damaging Het
Oscar T C 7: 3,611,063 probably benign Het
Paics A G 5: 76,966,255 I321V probably benign Het
Pappa A T 4: 65,307,774 H1288L probably benign Het
Pla2r1 T C 2: 60,515,046 E322G possibly damaging Het
Poldip2 T A 11: 78,521,228 M330K probably damaging Het
Recql5 T C 11: 115,893,944 probably null Het
Rnf145 A G 11: 44,561,657 M488V probably benign Het
Rrp1b T A 17: 32,050,039 D170E possibly damaging Het
Slamf7 T C 1: 171,640,998 S109G possibly damaging Het
Slf1 A G 13: 77,044,004 S904P possibly damaging Het
St7 C A 6: 17,749,546 probably benign Het
Stk25 A G 1: 93,627,668 S102P probably damaging Het
Supt6 C T 11: 78,225,722 A659T probably damaging Het
Tdrp A C 8: 13,953,918 S140A probably damaging Het
Thbs3 A G 3: 89,223,144 N527D probably benign Het
Tsnaxip1 G T 8: 105,842,210 V444L probably damaging Het
U2af2 A G 7: 5,068,043 I116V probably benign Het
Zfp931 C A 2: 178,069,616 probably null Het
Other mutations in Kif1bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kif1bp APN 10 62559339 nonsense probably null
IGL02127:Kif1bp APN 10 62578349 missense probably benign 0.00
IGL03304:Kif1bp APN 10 62559303 missense probably damaging 1.00
R0317:Kif1bp UTSW 10 62578082 unclassified probably null
R0408:Kif1bp UTSW 10 62566053 missense probably benign 0.37
R0462:Kif1bp UTSW 10 62559456 missense probably damaging 1.00
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1503:Kif1bp UTSW 10 62559408 missense probably damaging 0.98
R1830:Kif1bp UTSW 10 62559327 missense probably damaging 1.00
R3848:Kif1bp UTSW 10 62569470 missense probably damaging 1.00
R4486:Kif1bp UTSW 10 62563027 intron probably benign
R4488:Kif1bp UTSW 10 62563027 intron probably benign
R4489:Kif1bp UTSW 10 62563027 intron probably benign
R5137:Kif1bp UTSW 10 62578241 missense probably damaging 1.00
R5193:Kif1bp UTSW 10 62559396 missense possibly damaging 0.81
R5212:Kif1bp UTSW 10 62563129 intron probably benign
R5929:Kif1bp UTSW 10 62559402 missense probably damaging 1.00
R6179:Kif1bp UTSW 10 62563250 nonsense probably null
R6488:Kif1bp UTSW 10 62559658 intron probably null
R6513:Kif1bp UTSW 10 62575034 intron probably null
R6808:Kif1bp UTSW 10 62575144 missense possibly damaging 0.90
R6900:Kif1bp UTSW 10 62559129 missense probably damaging 1.00
R6916:Kif1bp UTSW 10 62566064 missense probably benign 0.05
R7092:Kif1bp UTSW 10 62578300 missense probably damaging 1.00
R7289:Kif1bp UTSW 10 62566116 missense probably damaging 1.00
R7376:Kif1bp UTSW 10 62559064 missense possibly damaging 0.89
R7672:Kif1bp UTSW 10 62578073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGCCTCATTTGCTATAGG -3'
(R):5'- TCGGCACTCAAGTACTACCAG -3'

Sequencing Primer
(F):5'- AGTGGCTTCAAGCTGCAC -3'
(R):5'- GGCACTCAAGTACTACCAGCTCTTC -3'
Posted On2016-06-09