Incidental Mutation 'IGL02980:Rrp1b'
ID392156
Institutional Source Beutler Lab
Gene Symbol Rrp1b
Ensembl Gene ENSMUSG00000058392
Gene Nameribosomal RNA processing 1 homolog B (S. cerevisiae)
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02980 (G1)
Quality Score129
Status Validated
Chromosome17
Chromosomal Location32036100-32062865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32050039 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 170 (D170E)
Ref Sequence ENSEMBL: ENSMUSP00000080085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081339] [ENSMUST00000150469] [ENSMUST00000151808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081339
AA Change: D170E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080085
Gene: ENSMUSG00000058392
AA Change: D170E

DomainStartEndE-ValueType
Pfam:Nop52 10 218 3.3e-73 PFAM
low complexity region 344 352 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 450 463 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150469
SMART Domains Protein: ENSMUSP00000117400
Gene: ENSMUSG00000058392

DomainStartEndE-ValueType
low complexity region 96 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151808
SMART Domains Protein: ENSMUSP00000123044
Gene: ENSMUSG00000058392

DomainStartEndE-ValueType
Pfam:Nop52 8 77 1.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156164
Meta Mutation Damage Score 0.2888 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,473 H232Y unknown Het
Acvr1b A G 15: 101,203,078 R374G probably damaging Het
Adam28 A T 14: 68,619,806 S584T probably benign Het
Akap1 A T 11: 88,845,164 I224N probably benign Het
Ankdd1b C T 13: 96,435,940 R214Q probably benign Het
Armt1 A G 10: 4,450,643 probably benign Het
C1rl T C 6: 124,508,528 I286T probably benign Het
Cdh23 T C 10: 60,314,620 T2528A probably damaging Het
Col4a4 A G 1: 82,469,477 probably null Het
Dag1 A G 9: 108,218,038 I85T probably benign Het
Elf2 A G 3: 51,264,958 V86A possibly damaging Het
Emsy T C 7: 98,619,380 T485A probably damaging Het
Fam169a T C 13: 97,113,680 probably null Het
Hsd17b4 A G 18: 50,146,518 H188R probably benign Het
Ighv9-2 C T 12: 114,109,219 V45M probably damaging Het
Kif1bp A C 10: 62,559,168 L565W probably damaging Het
Lama3 C T 18: 12,553,231 L2784F probably benign Het
Ms4a4c G T 19: 11,416,383 A64S probably benign Het
Nudt22 A G 19: 6,993,132 L280P probably damaging Het
Oscar T C 7: 3,611,063 probably benign Het
Paics A G 5: 76,966,255 I321V probably benign Het
Pappa A T 4: 65,307,774 H1288L probably benign Het
Pla2r1 T C 2: 60,515,046 E322G possibly damaging Het
Poldip2 T A 11: 78,521,228 M330K probably damaging Het
Recql5 T C 11: 115,893,944 probably null Het
Rnf145 A G 11: 44,561,657 M488V probably benign Het
Slamf7 T C 1: 171,640,998 S109G possibly damaging Het
Slf1 A G 13: 77,044,004 S904P possibly damaging Het
St7 C A 6: 17,749,546 probably benign Het
Stk25 A G 1: 93,627,668 S102P probably damaging Het
Supt6 C T 11: 78,225,722 A659T probably damaging Het
Tdrp A C 8: 13,953,918 S140A probably damaging Het
Thbs3 A G 3: 89,223,144 N527D probably benign Het
Tsnaxip1 G T 8: 105,842,210 V444L probably damaging Het
U2af2 A G 7: 5,068,043 I116V probably benign Het
Zfp931 C A 2: 178,069,616 probably null Het
Other mutations in Rrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Rrp1b APN 17 32052819 missense probably benign 0.09
IGL01383:Rrp1b APN 17 32058578 missense probably damaging 0.99
IGL02740:Rrp1b APN 17 32059331 missense probably damaging 1.00
IGL03030:Rrp1b APN 17 32056901 missense probably damaging 1.00
IGL03181:Rrp1b APN 17 32057176 missense probably benign 0.13
IGL03396:Rrp1b APN 17 32057263 splice site probably benign
R0138:Rrp1b UTSW 17 32060452 missense probably benign 0.24
R0394:Rrp1b UTSW 17 32058564 missense probably benign 0.34
R0681:Rrp1b UTSW 17 32060395 missense probably damaging 1.00
R1315:Rrp1b UTSW 17 32056639 missense probably benign 0.00
R1351:Rrp1b UTSW 17 32056637 missense possibly damaging 0.82
R1700:Rrp1b UTSW 17 32057204 missense probably benign 0.19
R1815:Rrp1b UTSW 17 32056811 missense probably benign
R1940:Rrp1b UTSW 17 32056845 missense possibly damaging 0.95
R2176:Rrp1b UTSW 17 32056560 missense probably benign 0.00
R2352:Rrp1b UTSW 17 32059328 missense possibly damaging 0.71
R2975:Rrp1b UTSW 17 32058573 missense probably damaging 1.00
R4552:Rrp1b UTSW 17 32056010 splice site probably benign
R5114:Rrp1b UTSW 17 32036471 utr 5 prime probably benign
R5242:Rrp1b UTSW 17 32051703 missense possibly damaging 0.82
R5647:Rrp1b UTSW 17 32056011 splice site probably benign
R5739:Rrp1b UTSW 17 32045976 missense probably damaging 1.00
R5853:Rrp1b UTSW 17 32056684 missense possibly damaging 0.49
R5878:Rrp1b UTSW 17 32047675 missense probably damaging 1.00
R6389:Rrp1b UTSW 17 32056627 missense possibly damaging 0.55
R6734:Rrp1b UTSW 17 32055304 intron probably benign
R6742:Rrp1b UTSW 17 32056934 missense probably benign
R6759:Rrp1b UTSW 17 32057089 missense probably benign 0.01
R6855:Rrp1b UTSW 17 32052745 missense probably benign 0.00
R7014:Rrp1b UTSW 17 32049427 missense probably damaging 1.00
R7315:Rrp1b UTSW 17 32058571 missense probably benign 0.03
R7689:Rrp1b UTSW 17 32055926 missense probably benign 0.38
R7834:Rrp1b UTSW 17 32051724 missense probably benign 0.00
R7917:Rrp1b UTSW 17 32051724 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCACGTTGTTATGCAGTATGAGC -3'
(R):5'- GTCCACTAGCTGTCTGAGAC -3'

Sequencing Primer
(F):5'- GTTGTTATGCAGTATGAGCAGTAAAC -3'
(R):5'- TCTGAGACAGGGTCCCAGGATG -3'
Posted On2016-06-09