Incidental Mutation 'IGL03052:Ccdc73'
ID392164
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Namecoiled-coil domain containing 73
Synonyms2210415I11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #IGL03052 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104867805-105017904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104951936 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 212 (H212Q)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000127840] [ENSMUST00000151764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111114
AA Change: H212Q

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: H212Q

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127840
SMART Domains Protein: ENSMUSP00000115091
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151764
AA Change: H212Q

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106
AA Change: H212Q

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A T 16: 4,977,494 noncoding transcript Het
5830411N06Rik G A 7: 140,248,914 C162Y probably damaging Het
Acap3 T C 4: 155,903,358 F517S probably damaging Het
Afap1l1 A G 18: 61,748,823 V267A probably benign Het
Asap1 A G 15: 64,153,834 probably benign Het
Bcl6 T C 16: 23,975,038 probably benign Het
Cct5 A T 15: 31,597,487 H85Q probably damaging Het
Cfap69 A C 5: 5,589,206 L238R probably damaging Het
Chl1 A T 6: 103,691,667 T470S probably benign Het
Cnga4 T C 7: 105,404,725 S12P probably benign Het
Cyp2c29 C T 19: 39,287,218 T34M possibly damaging Het
Cyp2c67 T C 19: 39,648,885 D49G possibly damaging Het
Dab2ip A G 2: 35,643,897 Q45R probably benign Het
Ddhd1 A G 14: 45,620,783 V164A probably damaging Het
Dnah7c A G 1: 46,632,149 Y1566C probably damaging Het
Dnase1l2 T C 17: 24,440,994 probably benign Het
Dock2 G T 11: 34,232,853 N1593K probably benign Het
Dpp6 G T 5: 27,709,508 M530I probably benign Het
Epm2a T C 10: 11,457,230 V269A possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fgf2 A G 3: 37,349,012 S55G probably benign Het
Frem3 C T 8: 80,614,530 P1151S probably damaging Het
Gm12666 A G 4: 92,191,050 L178P probably benign Het
Gm15737 T C 6: 92,869,500 probably benign Het
Gm1840 T A 8: 5,639,816 noncoding transcript Het
Gm4759 T C 7: 106,423,695 noncoding transcript Het
Hoxa3 G A 6: 52,170,287 probably benign Het
Macf1 T C 4: 123,387,395 I3770V probably damaging Het
Mapk15 G T 15: 75,993,882 R8L probably benign Het
Mecom C T 3: 29,960,963 probably benign Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Mrgprb3 A T 7: 48,643,593 V70E possibly damaging Het
Mtdh A G 15: 34,140,730 K570E possibly damaging Het
Myo5c G T 9: 75,252,516 probably benign Het
Myom2 T C 8: 15,123,442 probably benign Het
Olfr1489 T C 19: 13,633,726 I205T probably benign Het
Olfr553 C T 7: 102,614,449 R180Q probably benign Het
Olfr843 A T 9: 19,248,642 Y252* probably null Het
Pcca A T 14: 122,887,101 M695L probably benign Het
Pcdha2 A T 18: 36,941,617 D767V probably damaging Het
Plekhs1 G A 19: 56,470,757 D16N probably benign Het
Prr11 T C 11: 87,103,652 N56S possibly damaging Het
Rxfp2 A T 5: 150,043,180 probably benign Het
Sacs G T 14: 61,207,858 G2451V probably damaging Het
Scarb1 G A 5: 125,294,099 A4V probably damaging Het
Sik3 C A 9: 46,198,149 T475K probably damaging Het
Slco1b2 A T 6: 141,648,585 I59L probably benign Het
Sspo G A 6: 48,460,453 G1382R probably damaging Het
Stx16 C A 2: 174,092,438 P145T probably benign Het
Tnrc18 G A 5: 142,775,219 A674V unknown Het
Uqcrq A G 11: 53,430,649 V14A possibly damaging Het
Vmn2r79 A T 7: 87,003,591 E497V probably benign Het
Vps8 T A 16: 21,448,365 I166K probably damaging Het
Vwa8 A G 14: 79,064,921 D1010G probably benign Het
Wnk1 T A 6: 119,944,799 probably benign Het
Zfand3 T A 17: 30,060,824 M29K probably benign Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104994591 missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104907627 missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104975616 missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104907568 missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104991840 unclassified probably benign
FR4737:Ccdc73 UTSW 2 104991840 unclassified probably benign
R0010:Ccdc73 UTSW 2 104980987 splice site probably benign
R0040:Ccdc73 UTSW 2 104992084 missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104929570 splice site probably benign
R0360:Ccdc73 UTSW 2 104981007 missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104991289 missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104973154 splice site probably benign
R0839:Ccdc73 UTSW 2 104991097 missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104992190 missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104991561 missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104907610 missense possibly damaging 0.72
R1478:Ccdc73 UTSW 2 104914667 missense possibly damaging 0.93
R1695:Ccdc73 UTSW 2 104992105 missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104992292 missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104926935 missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104931045 nonsense probably null
R1987:Ccdc73 UTSW 2 104999159 missense probably damaging 1.00
R2938:Ccdc73 UTSW 2 104975635 nonsense probably null
R3420:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3420:Ccdc73 UTSW 2 104951948 splice site probably null
R3422:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3422:Ccdc73 UTSW 2 104951948 splice site probably null
R3522:Ccdc73 UTSW 2 104991485 missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104991343 missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104985010 missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104981105 splice site probably null
R4793:Ccdc73 UTSW 2 105017782 utr 3 prime probably null
R4939:Ccdc73 UTSW 2 104992157 unclassified probably null
R4950:Ccdc73 UTSW 2 104992366 missense probably benign
R5093:Ccdc73 UTSW 2 105017766 utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104992039 missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104989925 missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104930986 missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104992137 missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104907633 missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104992088 missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104991524 nonsense probably null
R7062:Ccdc73 UTSW 2 104951878 missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104973224 missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104999176 missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104951869 missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104994570 missense
R7747:Ccdc73 UTSW 2 104929556 missense probably damaging 1.00
Z1177:Ccdc73 UTSW 2 104992239 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAACAGTCAATGGCAGTTTAATGC -3'
(R):5'- TCCCCAAGAATGTATGTCTCTGATG -3'

Sequencing Primer
(F):5'- GCATTGCGTCTGTTCAT -3'
(R):5'- CAAGAATGTATGTCTCTGATGGTAAG -3'
Posted On2016-06-09